1. Research Computing, NYU School of Medicine
Teaching Bioinformatics to Undergraduates
Stuart M. Brown
Research Computing, NYU School of Medicine

2. I. What is Bioinformatics?
II. Challenges of teaching bioinformatics to undergraduates
III. Common bioinformatics tools that you can use for teaching
IV. The limits of knowledge
V. Resources for the teacher

3. I. What is Bioinformatics?
The use of information technology to collect, analyze, and interpret biological data.
The use of software tools that deal with biological sequences, genome analysis, molecular structures, gene expression, regulatory and metabolic modeling
Computational biology - the design of new algorithms and software to support biology research
The routine use of computers in all phases of biology and medicine

4. The Human Genome Project

5. A Genome Revolution in Biology and Medicine
We are in the midst of a "Golden Era" of biology
The Human Genome Project has produced a huge storehouse of data that will be used to change every aspect of biological research and medicine
The revolution is about treating biology as an information science, not about specific biochemical technologies.

6. The job of the biologist is changing
As more biological information becomes available …and laboratory equipment becomes more automated ...
The biologist will spend more time using computers
The biologist will spend more time on experimental design and data analysis (and less time doing tedious lab biochemistry)
Biology will become a more quantitative science (think how the periodic table affected chemistry)

7. II. Why teach bioinformatics in undergraduate education?
Demand for trained graduates from the biomedical industry
Bioinformatics is essential to understand current developments in all fields of biology
We need to educate an entire new generation of scientists, health care workers, etc.
Use bioinformatics to enhance the teaching of other subjects: genetics, evolution, biochemistry

8. Biochemistry & Protein Structures
"Hands-on graphics is a powerful enhancement to learning, particularly individualized learning. There is powerful synergy in learning about proteins and learning simultaneously about how to represent and manipulate them with computer graphics. When students learn to use graphics they see proteins and other complex biomolecules in a new and vivid way, and discover personal solutions to the problem of "seeing" new structural concepts."
Molecular Graphics Manifesto
Gale Rhodes
Chemistry Department, Univ. of Southern Maine

9. Challenges of presenting bioinformatics to undergraduates
Requires a deep understanding of molecular biology - lots of prerequisites
Training users or makers of these tools?
A good bioinformatics program will require substantially more math and statistics than most existing molecular biology and computer science curricula.
Who will teach?

10. Different Programs, Different Goals
Integrate into existing biology courses:
genetics, molecular biology, microbiology
Make one or a few cross-disciplinary courses
jointly taught by biology and computing faculty
open to both biology and computing students
Create a curriculum for a true bioinformatics major (is this a double major?)
Are you training for employment or providing the fundamentals for advanced training?

11. Shallow End
This workshop will focus on faculty skills needed at the shallow end of the continuum (a few lectures or a short course).
Use bioinformatics to teach biological concepts
Evolution
Genetics
Protein structure and function

12. How much Computing skills?
Bioinformatics can be seen as a tool that the biologist needs to use - like PCR
Or should biologists be able to write their own programs and build databases?
it is a big advantage to be able to design exactly the tool that you want
this may be the wave of the future
Is your school going to train "bioinformatics professionals" or biologists with informatics skills?"

13. Designing a Curriculum
To really master bioinformatics, students need to learn a lot of molecular biology and genetics as well as become competent programmers.
Then they need to learn specific bioinformatics skills - dealing with sequence databases, similarity algorithms, etc.
How can students learn this much material and still manage a well rounded education?
Graduates of these programs will become scientists and managers. Writing and presentation skills are essential components of their education.

14. Different Schools have Different Biases
There are still only a handful of bioinformatics undergraduate programs
[Many more schools offer a single course or a "specialized track" similar to a biotechnology major]
You can generally predict the bias according to what school/department hosts the program
Computer Science vs. biology
Biomedical engineering
Medical informatics (library science)

15. Teaching the Teachers
There are more graduate level bioinformatics programs, but they are all very new.
Graduates of these programs will have many opportunities as more schools gear up to offer bioinformatics training
The reality is that most schools will draft existing faculty - often jointly from Bio and CompSci departments
We need to train an entire generation of existing faculty in a new discipline

16. Teaching Tips Strike a balance between theory and practical experience
early bioinformatics training should be about what you can do with the tools
deeper training can focus on how they work
Balance the "click here" tutorials against letting them figure it out for themselves
it will be different when they look at it next time
real bioinformatics work involves finding ways to overcome frustrations with balky computer systems

17. Training "computer savvy" scientists
Know the right tool for the job
Get the job done with tools available
Network connection is the lifeline of the scientist
Jobs change, computers change, projects change, scientists need to be adaptable

18. III. Bioinformatics Tools You Can Use
GenBank - genes, proteins, genomes
Similarity Search tools: BLAST
Alignment: CLUSTAL
Protein families: Pfam, ProDom
Protein Structures: PDB, RasMol
Whole Genomes: UCSC, Entrez Genomes
Human Mutations: OMIM
Biochemical Pathways: KEGG
Integrated tools: Biology Workbench, BCM SearchLauncher

19. Large Databases
Once upon a time, GenBank sent out sequence updates on CD-ROM disks a few times per year.
Now GenBank is over 40 Gigabytes
(11 billion bases)
Most biocomputing sites update their copy of GenBank every day over the internet.
Scientists access GenBank directly over the Web

20. Finding Genes in GenBank
These billions of G, A, T, and C letters would be almost useless without descriptions of what genes they contain, the organisms they come from, etc.
All of this information is contained in the "annotation" part of each sequence record.

22. Entrez is a Tool for Finding Sequences
GenBank is managed by the NCBI (National Center for Biotechnology Information) which is a part of the US National Library of Medicine.
NCBI has created a Web-based tool called Entrez for finding sequences in GenBank.
Each sequence in GenBank has a unique “accession number”.
Entrez can also search for keywords such as gene names, protein names, and the names of orgainisms or biological functions

24. Entrez Databases contain more than just DNA & protein sequences

25. Type in a Query term Enter your search words in the
query box and hit the “Go” button

27. Refine the Query
Often a search finds too many (or too few) sequences, so you can go back and try again with more (or fewer) keywords in your query
The “History” feature allows you to combine any of your past queries.
The “Limits” feature allows you to limit a query to specific organisms, sequences submitted during a specific period of time, etc.
[Many other features are designed to search for literature in MEDLINE]

28. Related Items
You can search for a text term in sequence annotations or in MEDLINE abstracts, and find all articles, DNA, and protein sequences that mention that term.
Then from any article or sequence, you can move to "related articles" or "related sequences".
Relationships between sequences are computed with BLAST
Relationships between articles are computed with "MESH" terms (shared keywords
Relationships between DNA and protein sequences rely on accession numbers
Relationships between sequences and MEDLINE articles rely on both shared keywords and the mention of accession numbers in the articles.

30. Database Search Strategies
General search principles - not limited to sequence (or to biology)
Use accession numbers whenever possible
Start with broad keywords and narrow the search using more specific terms
Try variants of spelling, numbers, etc.
Search all relevant databases
Be persistent!!

32. >gb|BE588357.1|BE588357 194087 BARC 5BOV Bos taurus cDNA 5'.
Length = 369
Score = 272 bits (137), Expect = 4e-71
Identities = 258/297 (86%), Gaps = 1/297 (0%)
Strand = Plus / Plus
Query: 17 aggatccaacgtcgctccagctgctcttgacgactccacagataccccgaagccatggca 76
|||||||||||||||| | ||| | ||| || ||| | |||| ||||| |||||||||
Sbjct: 1 aggatccaacgtcgctgcggctacccttaaccact-cgcagaccccccgcagccatggcc 59
Query: 77 agcaagggcttgcaggacctgaagcaacaggtggaggggaccgcccaggaagccgtgtca 136
|||||||||||||||||||||||| | || ||||||||| | ||||||||||| ||| ||
Sbjct: 60 agcaagggcttgcaggacctgaagaagcaagtggagggggcggcccaggaagcggtgaca 119
Query: 137 gcggccggagcggcagctcagcaagtggtggaccaggccacagaggcggggcagaaagcc 196
|||||||| | || | ||||||||||||||| ||||||||||| || ||||||||||||
Sbjct: 120 tcggccggaacagcggttcagcaagtggtggatcaggccacagaagcagggcagaaagcc 179
Query: 197 atggaccagctggccaagaccacccaggaaaccatcgacaagactgctaaccaggcctct 256
||||||||| | |||||||| |||||||||||||||||| ||||||||||||||||||||
Sbjct: 180 atggaccaggttgccaagactacccaggaaaccatcgaccagactgctaaccaggcctct 239
Query: 257 gacaccttctctgggattgggaaaaaattcggcctcctgaaatgacagcagggagac 313
|| || ||||| || ||||||||||| | |||||||||||||||||| ||||||||
Sbjct: 240 gagactttctcgggttttgggaaaaaacttggcctcctgaaatgacagaagggagac 296

33. Sample Multiple Alignment

34. Protein domains (from ProDom database)

35. Limits on best Matched Annotation Inheritance
result from many things including multi domain proteins transitivity.
New sequence
Closest database annotated entry
Original studied protein from which
annotation was inherited.

36. Protein Structure
It is not really possible to predict protein structure from just amino acid sequence
PDB is a database of know protein structures (determined by X-ray crystallography and NMR)
There are also very handy structure viewers such as RasMol that are free for any computer

39. Genome Browsers
Scientists need to work with a lot of layers of information about the genome
coding sequence of known genes and cDNAs
computer-predicted genes
genetic maps (known mutations and markers)
gene expression
cross species homology

41. UCSC

42. Ensembl at EBI/EMBL

43. Human Alleles
The OMIM (Online Mendelian Inheritance in Man) database at the NCBI tracks all human mutations with known phenotypes.
It contains a total of about 2,000 genetic diseases [and another ~11,000 genetic loci with known phenotypes - but not necessarily known gene sequences]
It is designed for use by physicians:
can search by disease name
contains summaries from clinical studies

45. KEGG: Kyoto Encylopedia of Genes and Genomes
Enzymatic and regulatory pathways
Mapped out by EC number and cross-referenced to genes in all known organisms
(wherever sequence information exits)
Parallel maps of regulatory pathways

48. Integrated Online Tools
National Database/Sequence Analsysis Servers:
NCBI, EMBL/EBI, DDBJ
Tools for specific types of data or problems
Expasy (Protein, Mass Spec, 2-D PAGE)
3-D Protein Structures: PDB, Predict Protein Server
Education oriented tools
Biology Workbench
Collections of links to other servers
BCM SearchLauncher

54. The Limits of our Knowledge
Bioinformatics is a very dynamic discipline
Teachers can't know everything in the field
The databases are clumsily built
Biology is vastly more complex than our software
Lots of our current bioinformatics programs don't work well
We don't have even theoretical solutions for Gene prediction, alternative splicing, protein structure & function prediction, regulatory networks

55. What is a Gene? For every 2 biologists, you get 3 definitions
“A DNA sequence that encodes a heritable trait.”
The unit of heredity
Is it an abstract concept, or something you can isolate in a tube or print on your screen?
“Classic” vs.. “modern” understanding of molecular biology

56. Genome Confusion The sequence of a gene in the genome includes:
protein coding sequence
introns and exons
5' and 3' untranslated regions on the mRNA
promoter and 5' transcription factor binding sites
enhancers??
What about alternative splicing?
Multiple cDNAs with different sequences (that produce different proteins) can be transcribed from the same genomic locus

57. V. Teaching Resources The Biology Student WorkBench
RasMol/Chime/Protein Explorer
Bioinformatics.org
Other courses - It ain't cheating to learn from your peers

58. Terri Attwood's Web Biocomputing tutorials
Sequence Analysis on the Web
Christian Büschking and Chris Schleiermacher
Online Lectures on Bioinformatics
Hannes Luz, Max Planck Institute for Molecular Genetics
Using Computers in Molecular Biology
Stuart Brown, NYU School of Medicine
Teach Yourself Bioinformatics on the Web

59. Long Term Implications
A "periodic table for biology" will lead to an explosion of research and discoveries - we will finally have the tools to start making systematic analyses of biological processes (quantitative biology).
Understanding the genome will lead to the ability to change it - to modify the characteristics of organisms and people in a wide variety of ways

60. Genomics in Medical Education
“The explosion of information about the new genetics will create a huge problem in health education. Most physicians in practice have had not a single hour of education in genetics and are going to be severely challenged to pick up this new technology and run with it."
Francis Collins

61. Stuart M. Brown, Ph.D. stuart.brown@med.nyu.edu www.med.nyu/rcr
Bioinformatics: A Biologist's Guide to Biocomputing and the Internet
Stuart M. Brown, Ph.D.