1. Species complex What is a species? Morphology, phylogenetic distinctiveness, ecology Reproductive continuity (rem: definitions of populations) We discuss multiple species (evolutionary units) even if not "biological species" A very typical problem evolutionary biologists face Chapter 13

2. Implies chromosomal similarity Remember: humans and chimps very similar at sequence level, but 1000s of genes have been gained/lost between the two through duplication Hybridization referring to our close ancestors could have been possible, assuming reconstruction of Neanderthal genome correct

3. isolation-migration models IMAGINE: two species that you are studying with genetic markers, and you find out that they share some alleles how is that possible??? 1. clearly they hybridized, OMG, gross 2. or, diversity from the ancestral population has not yet been fixed for alternate alleles in the 2 populations coalescent theory lets us calculate these probabilities, and allow for isolation NOT being immediate And of course often outbreeding has fitness consequences

4. Coalescent simulations Recover possible historical scenario by simulation Ancestral diversity, current diversity, migration easy to simulate: does SIMULATED DNA carry same pattern as empirical data? If not, reject...if yes, consider as one possibility Easier to reject unlikely hypotheses than separate all likely hypotheses, increasing data helps may include effects of migration, change in population size, bottlenecks, and so on

5. Population expansion IN GENERAL: Series of bottlenecks, reduced diversity

6. 300,000 markers Cluster analysis recapitulates migration distances Mutation, drift, and migration reach equilibria that allow inference of past migration and interbreeding

7. Ah to be alive on a mid-September morn fording a stream barefoot, pants rolled up, holding boots, pack on, sunshine, ice in the shallows, northern rockies. Rustle and shimmer of icy creek waters stones turn underfoot, small and hard as toes cold nose dripping singing inside creek music, heart music, smell of sun on gravel. I pledge allegiance I pledge allegiance to the soil of Turtle Island, and to the beings who thereon dwell one ecosystem in diversity under the sun With joyful interpenetration for all. Gary Snyder

8. More than Feet... We are brains, language, art, emotion “There are many competing hypotheses for why we are the last hominins left on Earth...” Zimmer and Emlen We are monotypic - nothing else quite like us.

9. Dolphin brains we aren’t the only species with large brains...what is it about our brain that (we think) makes us so different? The discovery of spindle cells (neurons without extensive branching, known also as "von Economo neurons", or VENs) in the brains of the humpback whale, fin whale, sperm whale, killer whale, [15][16] bottlenose dolphins, Risso's dolphins, and beluga whales [17] is another unique discovery. Humans, the great apes, and elephants, species all well known for their high intelligence, are the only others known to have spindle cells [18] (p242). Spindle neurons appear to play a central role in the development of intelligent behavior. Such a discovery may suggest a convergent evolution of these species. [19]spindle cellshumpback whale fin whalesperm whalekiller whalebottlenose dolphinsRisso's dolphinsbeluga whalesconvergent evolution

10. art figurative art begins to appear in the fossil record around 40,000 years ago we are a visual species: reduced reliance on olfactory sense apes have a duplicated opsin gene lacking in other primates, has evolved into color vision may be key event in identifying ripe/safe food: overall reliance on vision

11. trichromatic vision is a complex adaptation as so often happens, it is a gene duplication that allowed it

12. language when traits are shared, that is evidence of recent common ancestry traits that vary between groups are evidence of ancient common ancestry culture evolves under similar rules as mutations in a gene linguistic similarities and differences evolve temporally processes of mutation and drift, non- random people with whom we share culture: assumptions about evolutionary models can apply to culture

13. 300,000 markers Cluster analysis recapitulates migration distances Mutation, drift, and migration reach equilibria that allow inference of past migration and interbreeding

14. how has selection continued to change us? as populations continue to find new habitats to live in, there are signs of adaptation rare alleles at EPAS1 locus found primarily in Tibetans: allow better survival at high altitude lactase persistence: allow additional calorie source to pastoral communities modern world may be relaxing selection in other ways

15. traits being selected often involve life history traits: age at first reproduction, body mass index, physiology, and trade- offs of these remember: selection context-specific, may be different in different locations, cultures...

16. emotion text: emotion causes motivation; motivation helps mammals reach goals such as food or mates traits of emotion coincide with development of particular neuronal structures, particular hormonal pathways (expressed proteins) Sanger-Schachter theory of emotion: emotion is a function both of cognition (thought) and physiological state these lead to the bonds we form: we know that oxytocin (involved in maternal bonding/imprinting with offspring) and vasopressin are two key players

18. on the topic of love... some mutations change the length of a particular fragment, and can have major phenotypic results

19. ctttcgatctctctctctctcgatac...... ctttcgatctctctctctctctctctcgatac simple sequence repeats (SSR) loci have motifs (“words”) that can easily mutate during replication strand slippage, increase or decrease number motifs not often within genes, but in non-coding regions that influence expression (e.g. between promoter region and gene)

21. proximity of promoter region influences rate of transcription (and thus amount of product) in voles (and other mammals, it seems) can affect number of vasopressin receptors in brain gene ctttcgatctctctctctctcgatac gene ctttcgatctctctctctctctctctctcgatac promoter

22. more vasopressin receptors in prairie vole more monogamy and social care by males fewer receptors in meadow vole - more promiscuity, and behavior can be changed by providing additional receptors

23. expression is behavior vasopressin receptor has variable expression across species higher levels of expression associated with strong pair- bonding (approaching monogamy) experimentally increasing expression of vasopressin receptor induces pair- bonding behavior

24. yes the homologous - orthologous - system works the same way in humans. homozygotes for particular allele classes have less persistent relationships as with MHC diversity influencing mate choice, our genes and simple physiological and genomic upregulation - out of our control - control much of what we do!

25. mhc MHC molecules “show” processed proteins on cell surface immune system responds (usually to your benefit) extreme diversity at this locus: why?

26. molecule with benefits diversity allows presentation/recognition of diverse pathogen/foreign material (helps immune system clear body of disease) greater diversity, better presumed immune response (heterosis, overdominance: two forms of increased fitness with heterozygosity) so life (vertebrates) might act to increase diversity somehow?

27. old shirts and mate choice Wedekind study: MHC dissimilar mates preferred? T-shirts worn by guys, presented to women - all genotyped at MHC loci greatest mismatch at genotype (different alleles) = greatest “attraction”

28. being unusual and mating

29. Incongruity of primate species tree and DQA1 promoter region gene tree. Loisel D A et al. PNAS 2006;103:16331-16336 ©2006 by National Academy of Sciences MHC- related gene