1. The Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University Ramat-Gan Hanny Seaman Advisors: Dr. Ido Bachelet Prof. Ron Unger 2013

2. 147236514723651324513245 NP-complete problem!

3.  DNA strands represent vertices and paths of a 7-node graph  Mix in tube – self complementarity  Filtration

4.  Folding of DNA to create nanoscale shapes  Terminology: ◦ Scaffold ◦ Staples  caDNAno

5.  Example: 4 vertices 0

6. 0 1

7. 0 1 2

8. 0 1 2 3

9. 0 1 2 3

10. 0 1 2 3

11. 0 1 2 3

12. 0 1 2 3

13. 0 1 2 3

14. 0 1 2 3

15. 0 1 2 3

16. StartEndSequenceLengthColor 0[45]0[26]GGGCGAAAAACCGTCTATCA20#aaaa00 0[64]0[46]CGTGGACTCCAACGTCAAA19#cc0000 1[26]1[45]TGTTGTTCCAGTTTGGAACA20#f74308 1[46]1[64]AGAGTCCACTATTAAAGAA19#03b6a2 2[45]2[26]TAGCCCGAGATAGGGTTGAG20#03b6a2 2[64]2[46]CCCTTATAAATCAAAAGAA19#aaaa00 3[26]3[45]GAAAATCCTGTTTGATGGTG20#f7931e 3[46]3[64]GTTCCGAAATCGGCAAAAT19#007200

19. Calculate the edges and vertices sequences

20. 12 7 6 5 4 3

22. 7 vertices – increase number of vertices

23. 1

24. 12

25. 12 3

26. 12 7 6 5 4 3

27. Unfolded segments Partial fold Max fold

28. 1

29. 1

30. 12

31. 12 5 4 3

32. 12 7 6 5 4 3

33. 12 7 6 5 4 3

34. (1) Beads (2) Beads Ver1-marked (3) Beads Ver7-marked (4) Beads Ver1 unmarked Vers 2-6 Ver7-marked All staples (5) Beads Ver1-marked Vers 2-6 Ver7-marked All staples

35. (5) (4) (3) (2) (1)

36. (5) (4) (3) (2) (1)

37.  Representing graph using origami DNA  Find if exists a Hamiltonian Path

38.  Watching folded DNA using AFM  Experiments with: ◦ edges including polyT ◦ Large number of vertices ◦ Graph with several paths – not only Hamiltonian

39.  לד " ר עידו בצלת ולפרופ ' רון אונגר על ההנחייה והליווי לאורך כל הפרוייקט.  לכל חברי המעבדה על העזרה.  תודה על ההקשבה !