1. Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks
Lee H. Harrison, MD
Associate Professor
Departments of Epidemiology and Medicine
University of Pittsburgh

2. What is molecular epidemiology in infectious diseases?
Purpose: Determine modes of transmission and source of infection
Principal: Exploit pheno-/genotypic differences between strains
Practice: Molecular subtyping of bacterial/fungal/viral/parasitic isolates

3. Molecular Epidemiology in Infectious Diseases: Why molecular methods?
Previously used methods:
antimicrobial susceptibility patterns
serologic/biochemical typing
Examples:
95% of invasive H. influenzae were serotype b
L. monocytogenes: 3 major serotypes (1/2a, 1/2b, 4b)

4. Molecular Epidemiology in Infectious Diseases: Basic Types of Methods
Genotypic methods
DNA based
Heritable and stable
Not affected by isolation/culture conditions
Phenotypic methods
Rely on expressed characteristics
Affected by isolation/culture/test conditions

5. Molecular Epidemiology in Infectious Diseases: Common Methods
Analysis of chromosomal DNA
Restriction endonuclease analysis (REA)
Pulse field gel electrophoresis (PFGE)
Restriction fragment length polymorphism (RFLP)
rDNA gene restriction patterns (ribotyping)
Nucleic acid sequencing
Nucleic acid hybridization of entire genome

6. Molecular Epidemiology in Infectious Diseases: Common Methods
Analysis of plasmid DNA
Plasmid size
Restriction digests
Protein analysis
Outer membrane protein (OMP) analysis
Multilocus enzyme typing (MLE)

7. Click for larger picture

8. Recognition Sequences of Selected Restriction Endonucleases
EcoR I
Hind III
Hha II
Source
Escherichia coli RY13
H. influenzae Rd
H. parainfluenze
Sequence
GAATTC
CTTAAG
AAGCTT
TTCGAA
CCGG
GGCC

9. DNA Cutting by HIND III: Staggered Cuts Leaving “Sticky” Ends
TTCGAATAAGCTTCCCTGAG
AAGCTTATTCGAAGGGACTC
TTCGAATA
AAGCTTATTCG
AGCTTCCCTGAG
AAGGGACTC +

10. General principals of molecular subtyping using restriction endonucleases
Bacterial chromosomal DNA . C . C . C . C
Electrophoresis . C . C . . . C C C C .
= Restriction endonuclease (“molecular scissors”)
= DNA sequence recognized by restriction endonuclease

12. Molecular Epidemiology in Infectious Diseases: Common Methods
Nucleic acid detection
Plasmid size
Restriction digests
Phage typing

14. Pulsed-Field Gel Electrophoresis

16. Genetic relatedness (dendrogram) analysis

17. Molecular Epidemiology in Infectious Diseases: Interpretation of Data
Heterogeneity within species
Must have knowledge of frequency distribution of subtypes
Utility of individual method is species specific

18. Molecular Epidemiology in Infectious Diseases: Requirements
Method must work with vast majority of isolates
Reproducibility
Discrimination power
Ease of method
Ease of interpretation