1. Discussion of Ecological Speciation in South Atlantic Island Finches by Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport University of Cape Town University of Pretoria South Africa Science 315:1420-1423 BIO101, Oct. 3, 2011

2. What’s the overall question? What’s the overall conclusion?

3. Ecological Speciation in South Atlantic Island Finches Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport Examples of sympatric speciation in nature are rare and hotly debated. We describe the parallel speciation of finches on two small islands in the Tristan da Cunha archipelago in the South Atlantic Ocean. Nesospiza buntings are a classic example of a simple adaptive radiation, with two species on each island: an abundant small-billed dietary generalist and a scarce large-billed specialist. Their morphological diversity closely matches the available spectrum of seed sizes, and genetic evidence suggests that they evolved independently on each island. Speciation is complete on the smaller island, where there is a single habitat with strongly bimodal seed size abundance, but is incomplete on the larger island, where a greater diversity of habitats has resulted in three lineages. Our study suggests that the buntings have undergone parallel ecological speciation.

4. Where in the world is Tristan da Cunha? The most remote inhabited islands in the world

5. Where in the world is Tristan da Cunha? Approx. 250 miles South Approx. 12 miles between

6. Inaccessible Island Rough circle, 2 miles in diameter. 3 million years old. Ecology largely stable for 20,000 years. Low coast with high cliffs. Extensive plateau of 300-600 m.

7. Nightingale Island Several small islands. Largest is approx. 1 mile diameter 18 million years old. Ecology largely stable for 20,000 years. Mostly low lying (<300 m)

8. The Flora Tall tussock grass, Spartina arundinacea Trees, Phylica Heath, Blechnum palmiforme

9. The Flora Inaccessible Island: Low-lying coast is mostly tussock grasses with a few clumps of trees East side of plateau is mostly Phylica trees West side of plateau is mostly heath Nightingale Island: Mostly tussock grass with a few clumps of trees Fig. 1A

10. Nesospiza Finches/Buntings Evolved from South American finches (crossed 4800 miles of ocean!) Two species: N. acunhae – also called Tristan Bunting wide variety diet small bill found on both islands differences in ‘upland’ and ‘lowland’ types on Inaccessible N. wilkinsi – also called Wilkins’ Bunting eats Phylica fruit large bill found on both islands

11. Nesospiza Finches/Buntings N. dunnei subspecies of N. wilkinsi only found on Inaccessible Island N. questi subspecies of N. acunhae only found on Nightingale Island Hybrids of dunnei x acunhae Hybrids only occur on Inaccessible Each species has a different subspecies

12. Nesospiza Finches/Buntings Fig. 1BC Allopatric Speciation: Species developed in geographic isolation, then dispersed and mixed Sympatric Speciation: One species inhabited both islands, large and small bills evolved on both islands

13. Morphological Analyses Found on Nightingale Island Found on Inaccessible Island More extreme morphological differences on Nightingale Fig. 2A

14. Ecological Analyses Fig. 2B Inaccessible

15. Ecological Analyses Fig. S1

16. Morphological and Ecological Analyses Which model do these data support? Allopatry? Sympatry? Both? Neither?

17. Genetic Analyses Analysis of a mitochondrial gene 9 birds on Nightingale analyzed. One genotype found, which is different from those on Inaccessible. Fig. S2 Which model do these data support? Allopatry? Sympatry? Both? Neither? Which factor is more important – species or location?

18. Genetic Analyses For higher resolution, conducted an analysis of a microsatellites Short, repetitive DNA sequences High levels of variation within species Variation in the number of repeats Generally between genes, so not selected for or against 372 birds analyzed for 7 microsatellites each CCGTAGATCGATCGATCTTACTGGT CCGTAGATCGATCGATCGATCGATCTTACTGGT

19. Table S2a Genetic Analyses Does the variation deviate from Hardy-Weinberg? p-values for a statistically significant deviation from Hardy-Weinberg: Microsatellite Names Five of the 42 loci/species combinations show evidence of evolution. (may be due to ongoing speciation) 37 of 42 show neutral variation.

20. Fig. 3B Genetic Analyses Visual representation of the microsatellite data. Each vertical line is one bird, with location and species/subspecies indicated. Colors code for genotypes at the four microsatellites 26 finches First bird shows ~65% “green” lineage ~25% “blue” lineage ~10% “gray” lineage slight amount of “red” lineage All N. wilkinsi finches on Nightingale are genetically similar to each other

21. Figure 3BC Genetic Analyses Each island/species grouping is well-resolved by the genetic data

22. Figure 3A Genetic Analyses Distance of lines corresponds to genetic distance. (Nei’s Genetic Distance, D) Can also present the microsatellite data as a tree:

23. Figure 3A Genetic Analyses Which model do these data support? Allopatry? Sympatry? Both? Neither? Which factor is more important – species or location?

24. Current Model: Buntings colonized Tristan da Cunha islands ~3 MYA (based on molecular clock data) Speciation occurred ~0.3-0.4 MYA Complete speciation on Nightingale Single habitat Speciation is not yet done on Inaccessible Greater habitat diversity Three lineages, including hybrids Sympatric Speciation!