1. Suppl. Figure 1 miR-107 levels NormalPituitary Tumors miR-103 levels miR-125b levels miR-141 levels miR-144 levels miR-164 levels miR-145 levels miR-143 levels miR-15b levels miR-16 levels miR-186 levels let-7b levels Pituitary Tumors Normal Suppl. Figure 1. Evaluation of the expression levels of differentially expressed microRNAs between pituitary normal and cancer tissues. MicroRNA expression levels were assessed by real-time PCR analysis in 5 normal and 12 cancer pituitary tissues. The experiment has been performed in triplicate and data are shown as mean ± SD.

2. Suppl. Figure 2 UGUUAGGGAAUUUUACUUGAA UGGAUAGGACUUAAUGAACUU 8-mer 3UTR PTEN miR-26b PTEN 132951278-84 3 UTR UGUGCAGCCACGUCACUGUGA UUUCUCUGGCCAAGUGACACU 8-mer 3UTR BMI1 miR-128 BMI1 11654459-65 3 UTR Suppl. Figure 2. Sequence complementarity between miR-26b and the 3UTR of PTEN gene and between miR-128 and the 3UTR of BMI1 gene.

3. Suppl. Figure 3 a -+--- as-miR NC # of colonies --+++ as-miR-26b ---+- siRNA NC ----+ siRNA-PTEN # of colonies -+--- as-miR NC --+++ as-miR-128 ---+- siRNA NC ----+ siRNA-BMI1 b -+--- as-miR NC --+++ as-miR-128 ---+- siRNA NC ----+ siRNA-BMI1 # of invading cells -+--- as-miR NC --+++ as-miR-26b ---+- siRNA NC ----+ siRNA-PTEN # of invading cells Suppl. Figure 3. MiR-26b and miR-128 control the tumorigenicity and invasiveness of AtT-20 pituitary tumors cell through regulation of PTEN and BMI1, respectively. (a) Number of colonies (mean ± SD) and (b) invading AtT-20 cells untreated or treated with 50nM antisense-microRNA negative control (as-miR-NC), antisense-microRNA-26b (as-miR-26b), antisense-microRNA-128 (as-miR-128), siRNA negative control (siRNA NC) and siRNA against PTEN (siRNA-PTEN).

4. # of colonies -+---- miR-NC --+--- as-miR-NC ---+-+ as-miR-26b ----++ miR-128 p<0.0001 # of invading cells -+---- miR-NC --+--- as-miR-NC ---+-+ ----++ miR-128 p<0.0001 as-miR-26b Suppl. Figure 4 a d PTEN mRNA levels -+---- miR-NC --+--- as-miR-NC ---+-+ as-miR-128 ----++ miR-26b e bc -+---- miR-NC --+--- as-miR-NC ---+-+ as-miR-128 ----++ miR-26b AKT phosph levels f # of colonies - +++ - +++ - -++ - --+ as-miR-26b miR-128 siRNA NC siRNA-PTEN # of invading cells - +++ - +++ - -++ - --+ as-miR-26b miR-128 siRNA NC siRNA-PTEN Suppl. Figure 4. MiR-26 and miR-128 regulate the PTEN-AKT pathway in AtT-20 pituitary cells. (a) Number of colonies and (b) invading AtT-20 cells, untreated or treated with 50nM miR-NC, as-miR-NC, as-miR-26b and miR-128. (c) Fold enrichment of BMI1 in the promoter area of PTEN in AtT-20 cells treated with 50NM as-miR-NC or as-miR-128, assessed by chromatin immunoprecipitation followed by real-time PCR analysis. (d) PTEN mRNA expression levels (mean ± SD) assessed by real-time PCR analysis and (e) AKT phosphorylation levels (S473) in AtT-20 cells treated for 48h with 50nM as-miR-NC, as-miR-128, miR- 26b and their combinations. (f) Number of colonies and invading AtT-20 cells, untreated or treated with 50nM as-miR-26b and miR-128 or combination of as-miR-26b, miR-128 and siRNA NC or combination of as-miR-26b, miR-128 and siRNA-PTEN. The experiments have been performed in triplicate and data are shown as mean ± SD.

5. Suppl. Figure 5 GH3 MtT/S # of invading cells - +++ - +++ - -++ - --+ as-miR-26b miR-128 siRNA NC siRNA-PTEN Suppl. Figure 5. Number of invading GH3 and MtT/S cells, untreated or treated with 50nM as-miR-26b and miR-128 or combination of as-miR-26b, miR-128 and siRNA NC or combination of as-miR-26b, miR-128 and siRNA-PTEN. The experiments have been performed in triplicate and data are shown as mean ± SD.