Presentation is loading. Please wait.

Presentation is loading. Please wait.

The History of Evolutionary Thought Lamarck believed that organisms had the ability to evolve when needed; animal evolved during its lifetime and passed.

Similar presentations


Presentation on theme: "The History of Evolutionary Thought Lamarck believed that organisms had the ability to evolve when needed; animal evolved during its lifetime and passed."— Presentation transcript:

1 The History of Evolutionary Thought Lamarck believed that organisms had the ability to evolve when needed; animal evolved during its lifetime and passed those changes onto its offspring The inheritance of acquired traits

2 Darwin and Natural Selection Where did he get his ideas from? Darwin visited the Galapagos Islands of the coast of S. America -different islands, each with slightly different environments

3 -Darwin noticed that were differences between the finches of each island -Finch ancestors came from S. America mainland -these observations led to the formation of Darwin’s Theory of Natural Selection

4 Natural Selection in a Nutshell 1.Overpopulation: Greater number of offspring produced than can survive to reproduce 2.Struggle for Existence: overpopulation causes organisms to compete for limited resources (food, water, place to live) 3.Variation: No two individuals exactly alike, some are better suited to their environment than others 4.Survival of the Fittest (N. Selection): Organisms that are better adapted to their environment are better able to compete, survive, and reproduce. Others die and do not reproduce 5.Origin of Species (Speciation): Over numerous generations, new species can develop by accumulated inherited variations

5 Current views of evolution -current evolutionary theory looks at the gene as a unit of evolutionary change

6 ATCGATCG Bases Phosphate Sugar Bases Review of DNA Nucleotide= 1 Base 1 Sugar 1 Phosphate

7 ATCGATCG Sugar/Phosphate Backbone Bases DNA Sides of ladder Rungs of ladder

8 ATCGGCATTTCAGCATATCCATGCATGCTGCTCCCGATG TAGCCGTAAAGTCGTATAGGTACGTACGACGAGGGCTAC DNA->Gene->Chromosome DNA strand Gene: small section of DNA There are many genes along the length of 1 DNA chain Can fold into x-shaped structures = 1 Chromosome ATCGGCATTTCAGCATATCCATGCATGCTGCTCCCGATGCTGCTTTCAGCATATCGGCAATGCATGCTATCGACGACG TCGGCATTTCAGCATATCCATGCATGCTGCTCCCGATGCTGCTTTCAGCATATCGGCAATGCATGCTATCGACGACGC

9 We now know that four distinct mechanisms generate evolution (change in allelic frequency in populations over time): 1. mutation 2. gene flow 3. genetic drift 4. selection (natural and “artificial”)

10 Genetics with Playing Cards Cards Activity Gene: each card # is a gene Allele: each card # has 4 suits or alleles Gene Pool: all cards in the deck (20) Population: 4 people holding cards Genetic Variation: different types of A-5 combinations Allelic Frequency: # of times a suit appears vs # of time for all alleles Sexual Reproduction: changes the combinations of suits (alleles) DOES NOT change allelic frequency

11 Consider how the amount of genetic divergence (change) forms a continuum: Microevolution Macroevolution small changes large changes Microevolution = adaptation Macroevolution = speciation

12 1. Mutation 1. Mutation = a heritable change in the nucleotide sequence of the genetic nucleic acid, resulting in an alteration in the products coded for by the gene T AAC CC G CG

13 2. Gene flow 2. Gene flow = introduction or loss of new alleles into the population through immigration or emigration.

14 3. Genetic drift 3. Genetic drift =shifts in allele frequencies in small populations; a particular allele may not be passed on very well simply by chance

15 4. Selection = 4. Selection = change in allele frequencies over generations due to differential survival and reproductive success of genotypes Darwinian evolution is evolution by natural selection

16 Adaptation and Natural Selection in Action In 19 th century England prior to the Industrial revolution, it was very common to see white Peppered Moths with very few black moths. The difference between the white and black moths was a single mutation. Even though the mutation was dominant very few black moths were present White Moth: ww Black Moth: Ww or WW

17 After Pollution Pollution from factories killed lichen covering trees and covered bark in black soot Now white moths were visible to predators and quickly disappeared leaving black form as most common

18 Types Of Evolution Divergent evolution Convergent evolution Co-evolution *see overhead


Download ppt "The History of Evolutionary Thought Lamarck believed that organisms had the ability to evolve when needed; animal evolved during its lifetime and passed."

Similar presentations


Ads by Google