1. PTT 104 Introduction to Biotechnology Lecture 3 Techniques in Biotechnology Recombinant DNA & PCR Miss Noorulnajwa Diyana Yaacob

2. Course Outcome CO 2: Ability to demonstrate important recent advances in methods and applications of biotechnology with regards to microorganisms and plants.

3. Biotechnology today Focuses on DNA Deoxyribonucleic Acid- a double-stranded helical molecule that stores genetic information for the production of all the organism’s proteinsFocuses on DNA Deoxyribonucleic Acid- a double-stranded helical molecule that stores genetic information for the production of all the organism’s proteins

4. What Is the Structure of DNA? What Is the Structure of DNA? DNA Is Composed of Four NucleotidesDNA Is Composed of Four Nucleotides DNA Is a Double Helix of Two Nucleotide StrandsDNA Is a Double Helix of Two Nucleotide Strands Many people contributed to the discovery, but Francis Crick and James Watson (and Maurice Wilkins) got the Noble prizes.Many people contributed to the discovery, but Francis Crick and James Watson (and Maurice Wilkins) got the Noble prizes.

6. Hydrogen Bonds Hydrogen bonds hold certain nitrogenous base pairs togetherHydrogen bonds hold certain nitrogenous base pairs together –A bonds with T, G bonds with C –Bonding bases called complementary base pairs Ladder-like structure of the two DNA strands are twisted into a double helixLadder-like structure of the two DNA strands are twisted into a double helix

7. What Is the Structure of DNA? Hydrogen Bonds Between Complementary Bases Hold the Two DNA Strands TogetherHydrogen Bonds Between Complementary Bases Hold the Two DNA Strands Together The Order of Nucleotides in DNA Can Encode Vast Amounts of InformationThe Order of Nucleotides in DNA Can Encode Vast Amounts of Information

9. Figure E9-6 Biology: Life on Earth 8/e ©2008 Pearson Prentice Hall, Inc. 5 end 3 end 5 end

10. Recombinant DNA DNA produced by joining segments of DNA from different sourcesDNA produced by joining segments of DNA from different sources eg. To produce human insulin, scientists have combined bacterial plasmid DNA + human DNAeg. To produce human insulin, scientists have combined bacterial plasmid DNA + human DNA

11. Tools for Producing Recombinant DNA Restriction enzymes: enzymes that cleave the DNA double helix at specific nucleotide sequences

12. Use of the Restriction Enzyme Bam H1 5’— G G A T C C — 3’ 5’— G G A T C C — 3’ 3’— C C T A G G — 5’ 3’— C C T A G G — 5’ 5’— G G A T C C — 3’ 5’— G G A T C C — 3’ 3’— C C T A G G — 5’ 3’— C C T A G G — 5’ sticky end Results in

14. Tools for Producing Recombinant DNA Vector: carrier of DNA; can be virus or plasmid Plasmid: extrachromosomal, independently replicating, small circular DNA molecule

15. Producing Recombinant DNA restriction enzyme Treat source DNA with restriction enzyme Treat plasmid DNA with same enzyme restriction enzyme Mix together Add DNA Ligase Many recombinant DNA molecules are produced, each with a different piece of source DNA Transform bacterial cells Each bacterial cell carries a different recombinant plasmid

16. Tools for Producing Recombinant DNA Probe: sequence of DNA that is complementary to the gene of interest; Used to locate a copy of the gene by hybridization Add Probe Probe Binds to gene AGCTTAGCGATTCGAATCGCTA AATCGC AGCTTAGCGATTCGAATCGCTA Denature DNA by heating

17. Building a DNA Library

18. Applying Your Knowledge A.An enzyme that cleaves DNA at specific sequences is a __________. B.A sequence of DNA that is complementary to the gene of interest is a _________. C.A small, independently replicating DNA molecule is a ___________. 1.Probe 2.Clone 3.Plasmid 4.Restriction Enzyme

19. Polymerase Chain Reaction PCR is a technique that is used to amplify a sample of DNA from miniscule amount of DNA (ex., DNA from a crime scene, archaeological samples, organisms that can’t be cultured).PCR is a technique that is used to amplify a sample of DNA from miniscule amount of DNA (ex., DNA from a crime scene, archaeological samples, organisms that can’t be cultured).

20. Who developed PCR? PCR was developed by Kary Mullis.PCR was developed by Kary Mullis. Kary Mullis is a scientist and surfer from Newport Beach, California.Kary Mullis is a scientist and surfer from Newport Beach, California. He won a Nobel Prize in Chemistry in 1993 for the development of PCR.He won a Nobel Prize in Chemistry in 1993 for the development of PCR. He was working for Cetus Corporation in the 70’s and received $10,000 bonus for the idea.He was working for Cetus Corporation in the 70’s and received $10,000 bonus for the idea.

21. How is PCR used? Medical Diagnosis: To detect and identify the causes of infectious diseases from bacteria and viruses.Medical Diagnosis: To detect and identify the causes of infectious diseases from bacteria and viruses. Genetic testing: To determine whether a genetic mutation has been passed on (ex. cystic fibrosis).Genetic testing: To determine whether a genetic mutation has been passed on (ex. cystic fibrosis). Evolutionary study: To gather archaeological samples and analyzed for similarities/differences.Evolutionary study: To gather archaeological samples and analyzed for similarities/differences. DNA fingerprinting: To profile DNA from blood, hair, and skin cells for criminal identification and forensicsDNA fingerprinting: To profile DNA from blood, hair, and skin cells for criminal identification and forensics

22. Stages of PCR PCR is divided into 3 stages: 1.Denaturation 2.Anneal 3.Extension

23. What is a primer? A primer is a short oligonucleotide which is the reverse complement of a region of a DNA template.A primer is a short oligonucleotide which is the reverse complement of a region of a DNA template. It would anneal to a DNA strand to facilitate the amplification of the targeted DNA sequence.It would anneal to a DNA strand to facilitate the amplification of the targeted DNA sequence. oligonucleotide

24. Primer Selection variables Primer lengthPrimer length Melting TemperatureMelting Temperature GC contentGC content Hair-pin loopHair-pin loop Self-dimerizationSelf-dimerization Cross-dimerizationCross-dimerization

25. Primer Length Should be between 18 – 25 bases.Should be between 18 – 25 bases. The longer the primer, the more inefficient the annealing.The longer the primer, the more inefficient the annealing. If primers are too short, they will cause non-specific annealing and end up amplifying non- specific sequences.If primers are too short, they will cause non-specific annealing and end up amplifying non- specific sequences.

26. Melting Temperature Formula (18-25 bp range):Formula (18-25 bp range): – T m = 2(A+T) + 4(G+C) The forward and reverse primers should be having similar T m, or else amplification will be less efficient.The forward and reverse primers should be having similar T m, or else amplification will be less efficient. Melting Temperature should be between 55ºC and 65ºC.Melting Temperature should be between 55ºC and 65ºC.

27. GC Content GC% = (G + C) / length of seq * 100%GC% = (G + C) / length of seq * 100% The base composition should be in the range of 45% to 55%.The base composition should be in the range of 45% to 55%. Poly G’s or C’s can result in non-specific annealing.Poly G’s or C’s can result in non-specific annealing.

28. Hairpin Loop Primers with hairpin loop may interfere with annealing to the template by forming partially double-stranded structure.

29. Self-dimerization Primers may form inter-primer homology with its own copies.

30. Cross Dimerization Forward and Reverse primers may hybridize to form primer-dimer.Forward and Reverse primers may hybridize to form primer-dimer.

31. Algorithm for primer design Input the start and end of central region Input the length of primers GC content 45-55% Tm: 55-65 o C Hairpin and self- dimerization Cross Dimerization Excluded primers N N Y Y Y Y N N List of acceptable primers Input DNA sequence

32. Polymerase Chain Reaction (PCR)  Amplifies a specific region in the DNA  Used for identification, especially if the amount of DNA is small  Uses repeated cycles of heating to denature DNA and cooling to synthesize new DNA  Involves the use of ---Taq polymerase (withstands heat) ---Taq polymerase (withstands heat) ---primers to begin synthesis ---primers to begin synthesis

33. Polymerase Chain Reaction: One PCR Cycle Original Double- helix DNA Separate DNA Strands 90 °C Primers & Taq polymerase bind 50 °C Taq Polymerase Primer 72 °C DNA synthesized