1. CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - structure - physico-chemical properties

2. CHMI 2227 - E.R. Gauthier, Ph.D.2 Nucleic acids Discovered in the 1869 by Friedrich Meischer:  Acid material found in the cell’s nucleus;  Called the stuff nuclein; Later work by others showed that nucleic acids were mostly made of:  Phosphorus  Nitrogen  Carbon  Oxygen Two types of nucleic acids exist:  Deoxyribonucleic acid (DNA)  Ribonucleic acid (RNA) BUT: what’s the big deal?

3. CHMI 2227 - E.R. Gauthier, Ph.D.3 Hershey and Chase The Waring blender experiment… 32 P in nucleic acids only 35 S in proteins only (Met/Cys)

4. CHMI 2227 - E.R. Gauthier, Ph.D.4 Nature of nucleic acids 1. nitrogenated bases 5 nitrogenated bases exist:  Purines: Adenine Guanine  Pyrimidines Cytosine Thymine Uracil

5. CHMI 2227 - E.R. Gauthier, Ph.D.5 Nature of nucleic acids 2. sugars Two types of 5-carbon sugars are found in nucleic acids:  Ribose (RNA)  2’Deoxyribose (DNA) Sugar pucker:  2’ endo: C2’ above the ring  3’ endo: C3’ above the ring

6. CHMI 2227 - E.R. Gauthier, Ph.D.6 Nature of nucleic acids 3. nucleosides The formation of a covalent bond (glycosidic bond) between the sugar and a nitrogenated base forms nucleosides H Deoxyadenosine Glycosidic bond 1’1’ 9 1 1’1’ Cytidine H

7. CHMI 2227 - E.R. Gauthier, Ph.D.7 Purines BaseDNARNA AdenineDeoxyadenosineAdenosine GuanineDeoxyguanosineGuanosine Nature of nucleic acids 3. nucleosides Pyrimidines BaseDNARNA Cytosine DeoxycytidineCytidine ThymineDeoxythymidine- Uracil-Uridine

8. CHMI 2227 - E.R. Gauthier, Ph.D.8 Nature of nucleic acids 3. nucleosides

9. CHMI 2227 - E.R. Gauthier, Ph.D.9 Nature of nucleic acids 4. nucleotides Nucleotides are nucleosides bearing one or multiple phosphate groups, usually at position 5’ of the sugar; Guanosine 5’monophosphate Deoxythymidine 5’triphosphate Alpha  Beta  Gamma 

10. CHMI 2227 - E.R. Gauthier, Ph.D.10 Number of phosphate groups Deoxynucleotide/Nucleotide 1Deoxyadenosine-5’-monophosphate 2Deoxyguanosine-5’-diphosphate 3Adenosine-5’-triphosphate Nature of nucleic acids 4. nucleotides

11. CHMI 2227 - E.R. Gauthier, Ph.D.11 Nature of nucleic acids 5. polynucleotides Nucleotides and deoxynucleotides form polymers called polynucleotides The nucleotides are linked together through phosphodiester bonds;  Involves the 3’OH of a nucleotide and the 5’  phosphate of another nucleotide; The order of the bases in a polynucleotide is the primary structure or sequence of the nucleic acid; Polynucleotides have a polarity:  5’ end: the 5’phosphate not involved in a phosphodiester bond  3’end: the 3’OH not involved in a phosphodiester bond;

12. CHMI 2227 - E.R. Gauthier, Ph.D.12 Nature of nucleic acids 5. phosphodiester bond http://www.mbi.ufl.edu/facilities/msg/bch4024m/lecture45.pdf  

13. CHMI 2227 - E.R. Gauthier, Ph.D.13 Nature of nucleic acids 6. Chargaff’s rules

14. CHMI 2227 - E.R. Gauthier, Ph.D.14 Structure of nucleic acids 1. DNA DNA is made of two antiparallel polynucleotide chains (they run in opposite direction); The bases are almost perpendicular to the axis of the structure (tilt of 6 o ); The base are shielded inside the structure, with the sugar-phosphate backbone on the outside; The two chains are held together through hydrogen bonding between nitrogenated bases:  A forms 2 H-bonds with T (AT base pair)  G forms 3 H-bonds with C (GC base pair) This A:T and G:C relationship dictates the complementarity of the two chains:  The nature of the base on one strand dictates the nature of the base on the complementary strand; bases Sugar/phosphate backbone

15. CHMI 2227 - E.R. Gauthier, Ph.D.15 Structure of nucleic acids 1. DNA The two polynucleotide chains from a right-handed helix:  Approx 10 base pairs/turn;  Rise: 3.4 Å per base  34 Å per turn  20 Å in diameter  Sugar pucker: 2’ endo  Glycosidic bond: anti Presence of two grooves on the side of the helix:  Minor groove: narrow space between the sugar/phosphate backbones of the 2 chains  Major groove: wide space between the sugar/phosphate backbones of the 2 chains 1 Å (Ångstrom) = 0.1 nm = 1 x 10 -10 m

16. CHMI 2227 - E.R. Gauthier, Ph.D.16 Structure of nucleic acids 1. DNA Stability of the helix:  Multiple H bonds between the two chains; 2 H bonds in AT 3 H bonds in GC  Stacking of the bases (e.g. stack of pennies): Stacks of GC stacks are more stable; So, a DNA molecules rich in GC base pairs will be more stable than a DNA molecue composed mostly of AT base pairs

17. CHMI 2227 - E.R. Gauthier, Ph.D.17 Structure of nucleic acids 2. DNA/RNA hybrids and RNA duplexes Double stranded RNA molecules follow the same basic rules as DNA molecules:  Complementarity  Antiparallellism However, the 2’OH found in RNA will lead to changes in the structure of the helix:  Wider: 26 Å  Shorter: 11 bp/turn  Rise: 2.6 Å  Bases are tilted (20 o )  Sugar pucker: 3’endo

18. CHMI 2227 - E.R. Gauthier, Ph.D.18 Structure of nucleic acids 2. DNA/RNA hybrids and RNA duplexes

19. CHMI 2227 - E.R. Gauthier, Ph.D.19 Structure of nucleic acids Java applets:  http://www.moleculesinmotion.com/

20. CHMI 2227 - E.R. Gauthier, Ph.D.20 DNA absorbance Nucleic acids absorb light at ~260 nm (due to purine/pyrimidine bases); Usually: pure nucleic acids will give a ratio A 260 / A280 of around 1.8; A 260 / A280 lower than 1.8 are usually interpreted as contamination of the nucleic acids by proteins. WHY??? Rule of thumb: an absorbance of 1 at 260 nm equals:  50 µg / ml of DNA  40 µg / ml RNA

21. CHMI 2227 - E.R. Gauthier, Ph.D.21 DNA denaturation Double-stranded (ds) nucleic acids can be made single-stranded (ss) (i.e. denatured) by:  increasing the temperature  decreasing the salt concentration  Chemicals: NaOH/formamide/formaldehyde (break H bonds) Conversely, single-stranded nucleic acids can be made to renature (i.e. anneal) by:  Decreasing the temperature  Increasing the salt concentration This phenomenon can be followed by spectrophotometry:  ss nucleic acids absorb more at 260 nm than ds nucleic acids: hyperchromic shift;

22. CHMI 2227 - E.R. Gauthier, Ph.D.22 DNA denaturation The temperature at which 50% of the ds nucleic acid is denature is called the melting temperature (Tm); The Tm is affected by several factors:  Salt concentration: Tm increases with increasing [NaCl];  Hybrid length: Tm increases with length (only for DNA < 150 bp)  G+C content: The more GC the higher the Tm; Tm = 4 (G + C) + 2 (A+T) What is the Tm of the following DNA molecule: 5’ GACTAGATCGATGGCTTCGATACC 3’ 3’ CTGATCTAGCTACCGAAGCTATGG 5’ Hyperchromic shift DNA#1 DNA#2

23. CHMI 2227 - E.R. Gauthier, Ph.D.23 DNA denaturation A+T-rich G+C-rich

24. CHMI 2227 - E.R. Gauthier, Ph.D.24 Hybridization ss nucleic acids with complementary sequences will anneal when mixed together (hybridization);  DNA-DNA  DNA-RNA  RNA-RNA The annealing will occur even if two strands are not perfectly complementary; However, the Tm will decrease with increasing mismatches; This phenomenon is widely used when studying nucleic acids:  DNA sequencing  PCR  Southern Blot  Northern Blot  FISH analysis  Microarrays

25. CHMI 2227 - E.R. Gauthier, Ph.D.25 Agarose gel electrophoresis +- Power Scanning Electron Micrograph of Agarose Gel (1×1 µm)  Polymerized agarose is porous, allowing for the movement of DNA DNA

26. CHMI 2227 - E.R. Gauthier, Ph.D.26 Agarose gel electrophoresis DNA molecules of known length Standard curve: Log length vs distance migrated Staining with ethidium bromide Ethidium bromide fluoresces red only when it intercalates between base pairs.

27. CHMI 2227 - E.R. Gauthier, Ph.D.27 Southern blot and Northern blot In Southern blot, DNA molecules are run on the gel and probed:  Widely used to study the structure of genes In Northern blot, RNA molecules are run on a gel and probed:  Widely used method to determine the location and level of expression of one’s favourite gene; 32 P-labeled nucleic acid probe is complementary to one of the DNA molecules on the gel Annealing

28. CHMI 2227 - E.R. Gauthier, Ph.D.28 Southern blot Genomic DNA cut with restriction enzyme Different allele?

29. CHMI 2227 - E.R. Gauthier, Ph.D.29 FISH Fluorescent in-situ hybridization FISH is used to locate the position of a gene of interest on a chromosome; A nucleic acid probe complementary to the gene of interest is labelled with a fluorescent dye, and hybridized to chromosomes (metaphase spread);