1. DNA Technology: Revolution in Evolution

2. Why study (organic) evolution? Evolution: descent with modification To understand natural history of life on earth To understand disease processes and public health risks –Immunity –Host-specificity –Risk assessment

3. ObservationPropose Hypothesis Refine Hypothesis Repeat Experiment Determine if Data are Bias Collect and Analyze Data Design Experiment Redesign Experiment Repeatable Not repeatable Data are Bias Propose Alternate Hypothesis Accept as Theory

4. Original population Population after selection Spectrum of characteristics in population Different selection processes Effects of Natural Selection on Populations

5. Divergence in a Population

6. Darwin’s Disadvantages Didn’t have knowledge of principles of inheritance (but made very good predictions) Made analogy between natural selection and artificial selection (a good hypothesis) but didn’t have the skills to test it thoroughly

7. Advances in Evolutionary Science: Contributions to the Neo-Darwinian Synthesis Principles of inheritance Linkage and mutation ‘Genes’ are the basis for inheritance and are found within chromosomes Discovery that DNA is the molecular material of genes, cracking genetic code Molecular mechanisms worked out for DNA replication and protein synthesis Multiple methods invented to study genetic variation and evolution

8. Cross-sectional data Cross-sectional data (snap-shot in time) can be used scientifically to make deductions about a process

9. Evolutionary science is like criminal forensics The crime may not have any witnesses The evidence is often patchy and comes in many forms In the absence of eyewitness accounts, DNA is often the most convincing evidence The best evidence is based on DNA sequence variation

10. DNA

11. Genetic Variation Results from Mutation Most mutations are either harmful, or neutral, but sometimes they are beneficial. If the mutations are not too harmful, they will be passed on to their progeny (offspring). This is the hereditary basis of evolution. These heritable changes in a lineage or populations of organisms over generations contribute to micro-evolution

12. the red fox ran out the red fax ran out thr edf oxr ano ut Point mutation Frame shift Mutations Analogy

13. Variation by Mutation is Compounded by Genetic Recombination Sexual reproduction Bacterial transformation Bacterial conjugation Virus-mediated gene transfer Other transfer between symbionts

14. DNA technology Facilitates the study of heritable characteristics between individuals, within populations and higher taxa Population genetics studies- field studies of evolutionary processes Phylogenetics- infer evolutionary relationships (family trees) from genetic similarity

15. Longitudinal vs cross-sectional Phylogenetic analysis examines relationship from cross-section Population genetic studies can follow gene flow over time

16. DNA microarrays PCR based methods Molecular (DNA) Methods Restriction Enzyme Digestion –RFLP –PFGE –Ribotyping Combination of methods DNA sequencing

17. RFLP RFLP-restriction fragment length polymorphisms DNA Organism A Organism B Restriction Endonuclease- enzyme that cleaves DNA at palandromic sequences. Example: EcoRI cuts at GAATTC RE

18. Gel Electrophoresis Gel Made of Translucent, Porous Matrix DNA samples added to wells in matrix DNA migrates at a rate inversely related to log10 of amplicon size + - EtBr binds to DNA as it travels through the gel

19. Visualizing DNA with UV light Large pieces of DNA Small pieces of DNA L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 L _ +

20. Ribotyping DNA EcoRI cells Transfer to nylon membrane (Southern Blot) 1% Agarose Gel Bind labeled 16S rDNA Probe - + Gel electrophoresis Anti-probe Ab and enzyme-linked color reaction

21. PFGE (Pulse Field Gel Electrophoresis) ++ - - Agarose gel

22. PCR polymerase chain reaction Invented by Kary Mullis in 1983 As soon as 1984 it was used for identification of unknown DNA Now widely used for many types of scientific research

23. Concept Amplify small quantities of DNA by in vitro DNA replication Target DNA PCR Copies of Target DNA

24. Generalized PCR cycle repeated ca. 40 times 94 degrees Celsius- denaturation Ca.45-60 degrees- primer annealing 72 degrees Celsius- extension Target sequence Taq

25. 1 st Cycle 2 nd Cycle Single copy of dsDNA target 3 rd Cycle Amplicons increase exponentially with each cycle

26. Variations of PCR technique Repetitive element PCR RAPD PCR Primers bind where ever there is a complemetary DNA sequence

27. Can be used to generate qualitative or quantitative data L 1 2 3 - Positive Charge Negative Charge L 1 2 3 -

28. DGGE denaturing gradient gel electrophoresis Gel made of substance that denatures DNA molecules Denaturing agent exists in a gradient from top to bottom PCR amplicons with different sequences will denature at different distance from the top

29. DNA sequencing DNA usually in the form of PCR amplicon One strand at a time Most thorough method of studying variation Relatively expensive and time consuming

30. Extension (polymerization) 3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’ATCGAACGGAGACTTACTCTTA Taq CA A T G C A T A G T T A 3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… Taq 5’ATCGAACGGAGACTTA dNTPs are randomly- incorporated into new strand until a ‘stop’ is added

31. Possible fragments A G C T T A G T If there is contradictory info, it will be read as ‘N’

32. Sequence Trace