1. What does it mean, in practice? 100%

2. Members of our community are only slightly less different from us than members of distant populations 85% 100%

3. Variances among continents are small, but not zero. Do genotypes naturally cluster in continental or subcontinental groups?

4. Assigning a genotype to its continent by discriminant analysis training dataset query genotype ?

5. Genes, as well as morphology, suggest inconsistent clusterings of genotypes Africa Asia, Europe, Australia, Americas Americas Africa, Asia, Americas, Oceania Asia Europe Africa, Asia, Europe Oceania Y chromosome: Romualdi et al. 2002 Alu insertions: Romualdi et al. 2002 X chromosome: Wilson et al. 2001 Europe, Ethiopia S. Africa N. Guinea Asia

6. Genes, as well as morphology, suggest inconsistent clusterings of genotypes 377 STR loci: Rosenberg et al. 2005 Melanesia Eurasia N Africa N America Maya S. Africa 377 STR loci: Barbujani and Belle 2006 E Africa C Africa Piapoco Suruì Karitiana Kalash W. Eurasia E. Asia Africa Americas Oceania

7. Genomic boundaries inferred from diversity at 377 STR loci (Barbujani and Belle 2006)

8. Less than 8% of the alleles are continent-specific, and more than half of these are African Rosenberg et al. (2002)

9. Avg. numbers of haplotype blocks in 51 genome regions (1.5 million base pairs): limited continental differentiation

10. Africa is special: Genetic diversity in all continents is often a subset of African genetic variation Tishkoff et al. (1998)

11. Approximate inferred colonization dates Human genetic diversity largely reflects patterns of migration

12. A pointillist view of human evolution and variation: 1 © 1999 Kenneth K Kidd, Yale University

13. A pointillist view of human evolution and variation: 2 © 1999 Kenneth K Kidd, Yale University

14. A pointillist view of human evolution and variation: 3 © 1999 Kenneth K Kidd, Yale University

15. Genetic evidence on modern humans’ origins Extensive allele sharing across continents Extensive haplotype sharing across continents Largest proportion of human genetic diversity within populations No obvious continental clusters of populations Genetic diversity out of Africa a subset of African diversity Broad-scale clines We are a young and mobile species

16. Il nostro genoma è molto piccolo Il nostro genoma è molto grande I nostri genomi sono molto simili I nostri genomi sono molto differenti La diversità genomica umana

17. Mind the numbers Humans and chimps share >98% of their genomes Among the 2% differences, 1.9% are fixed differences within species The remaining fraction, 0.1%, contains all human genomic variation 85% of that 0.1% represents differences among members of the same population The differences among the main racial or continental groups represent 10% of 0.1% of the total, that is, 0.01% But 0.01% of 3 billion DNA sites means 300 000 variable sites

18. DNA-based forensic identification Many DNA regions are characterised by a Variable Number of Tandem Repeats (VNTR): …CTAGACCCGAGAGAGAGAATTCCATGC… [5] …CTAGACCCGAGAGAGAATTCCATGC… [4] …CTAGACCCGAGAGAGAGAGAGAATTCCATGC… [7] Each of us carries a potentially unique combination of alleles at VNTR loci

19. Isolation of VNTRs

20. DNA fingerprinting Alec Jeffreys et al.: Hypervariable minisatellite regions in human DNA, Nature, 314:67-73, 1985.

21. DNA fingerprinting: an application

23. DNA fingerprinting: a paternity case

24. A case of sexual violence

25. But if races do not exist, how come forensic scientists are so good at finding them? a. UK forensic classification (before 2005): European, Afro-Caribbean, Indian Subcontinent, South East Asian, Middle Eastern b. UK forensic classification (after 2005) White-British, White-Irish, White-other, Asian-Indian, Asian-Pakistani, Asian-Bangladeshi, Asian-other, Black- Caribbean, Black-African, Black-other, Chinese, + 4 razze miste e Other c. USA forensic classification Caucasian, African-American, East Asian, Hispanic, Native American d. Bribri classification Bribri, ña Any list can be Ok for certain purposes, no list gives an all-purpose biological classification of humankind

26. Think about Hispanics

27. Consigli e sconsigli