1. WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein

2. WormBase Web Site

3. WormBase is a MOD u Model Organism Database u Repository for reagents –Genetic stocks, vectors, clones u Genetic maps u Large-scale data sets –Genome, EST sets, microarrays, interactions u Literature u Meetings, announcements, etc

4. Other MODs u FlyBase (Drosophila) u WormBase (Caenorhabditis) u SGD (Saccharomyces) u TAIR (Arabidopsis) u MGD (Mus) u PlasmoDB (Plasmodium) u RatDB (Rattus)

5. C. elegans Fun Facts u 1.5 mm length u 2 week life span u 959 cells u 302 neurons u 6 chromosomes u 100,258,171 bp (95 Ns) u 19,000 genes u 2,000 mutant strains

6. WormBase Fun Facts u 402,076 Sequences u 121,671 Proteins u 143,708 Clones u 24,728 Primer pairs u 15,022 Papers u 12,552 Loci u 2,944 Cells u 14 Maps u 7,200 RNAi results u 332 Transgenes u 19,713 Expression Patterns

7. WormBase Tour: Looking for MAP Kinase Kinase

8. Found a Genetic Locus: mek-2 mek-2 Phenotype & Expr Pattern mek-2 RNAi Studies

9. mek-2 RNAi Phenotype

10. mek-2 Sequence View

11. mek-2 Protein View

12. mek-2 Genome View

13. mek-2 PCR Assays

14. mek-2 Bibliography

15. mek-2 Citation

16. VB1 Neuron

17. VB1 Synapses

18. VBx Neuroanatomy

19. Advanced Searches (1)

20. Advanced Searches (2)

21. Advanced Searches (3)

22. Ad Hoc Queries

23. Bulk FTP Downloads u Genomic sequence –DNA (fasta) –Feature files (GFF) –C. briggsae DNA u ESTs (fasta) u WormPep u Non-coding RNAs u All the software (Open Source)

24. Recently Added: C. briggsae u C. elegans sequencing consortium (WashU + Sanger Center) u Whole genome shotgun + 12 Mb previously-finished BACs from WashU u 142 scaffolds u N 50 = 1,450 kb u 21,000 predicted genes u 11,000 genes orthologous to elegans

25. Accessing briggsae via elegansCorresponding region in briggsae

26. Synteny/Orthology Display

27. WormBase Usage

28. WormBase Hits by Domain

29. Major Referrers

30. Top Pages

31. How WormBase Works ACeDB Images, Movies Database access library Web server Perl scripts You MySQL Genomic Data

32. WormBase Information Workflow.ace SangerCalTechWashUNCBICGC

33. WormBase Information Workflow.ace SangerCalTechWashUNCBICGC Sanger

34. WormBase Information Workflow.ace SangerCalTechWashUNCBICGC Sanger CSHL www.wormbase.org

35. WormBase Information Workflow.ace SangerCalTechWashUNCBICGC Sanger CSHL www.wormbase.org CalTech Caltech.wormbase.org

36. Curating a Paper Database EntryGene Record Cell Record Mutant Record Domain Expert Clipping Service.ACE Files.ACE File CalTechAce

37. Curating the Genome (1) >CHROMOSOME_I gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaag… List of Features Gene Prediction Repeat Finding EST Alignment

38. Curating the Genome (2) List of Features ACeDB Sequence Editor CamAce StlAce

39. CSHLAce Curating Other Data Sets Knockout Consortium GO Consortium C. elegans Microarray Consortium RNAi Labs ORFeome Project

40. Build Process CamAce StlAceCalTechAceCSHLAce BuildAce WormBase integrate reconcile

41. The GMOD Project u Generic Model Organism Database u Generic MOD web site u Database schemas u Standard operating procedures u Annotation tools u Analysis tools u Visualization tools http://www.gmod.org

42. Released Modules u Apollo genome annotation editor u GBrowse generic genome browser u PubSearch literature curation system u LabDoc SOP editor u CMap comparative map viewer u GOET ontology editor u Chado modular database schema

43. GBrowse

44. Zoomed Way In

45. Zoomed Way Way In

46. Zoomed Way Way Out

47. Keyword Search

48. Sequence Search

49. Third Party Annotations

50. Links to 3d Party Web Sites

51. Uploaded Your Own Annotations

52. Sequence dumps & other reports

53. Extensively Customizable u End-user –Turn tracks on and off, change order, change packing & labeling attributes (stored in cookie) u Data provider –Change fonts, colors, text. –Change overview – genetic map, contigs, coverage, karyotype. –Define new tracks using simple config file. –Tinker with track appearance to hearts content.

54. Adding a New Track (a) Create a GFF file named “deletions.gff” Chr1 targeted deletion 1293224 1294901... Deletion d101k2 Chr1 targeted deletion 8239811 8241116... Deletion d680k2 Chr2 targeted deletion 5866382 5866500... Deletion d007k2 (b) Run the load_gff.pl script > load_gff.pl –d example_database deletions.gff Loading features… Done. 3 features loaded. (c) Add a new track “stanza” to the gbrowse configuration file [Knockout] feature = deletion glyph = span fgcolor = red key = Knockouts link = http://example.org/cgi-bin/knockout_details?$name citation = These are deletion knockouts produced by the example knockout consortium (http://example.org/knockouts.html)

55. Extensively Extensible Apache Web Server gbrowse CGI script BioPerl library Bio::DB::GFF adaptor Chado adaptor MySQL Plugins Bio::Graphics library Oracle Oracle adaptor (alpha test) Flat File adaptor Flat Files Glyphs

56. GBrowse on GenBank? Apache Web Server gbrowse CGI script BioPerl library Plugins Bio::Graphics library Glyphs GenBank Proxy Adaptor GenBank GBrowse on GenBank! Bio::DB::GFF adaptor MySQL

57. B. burgdorferi via GenBank proxy

58. WormBase People CalTechCold Spring Harbor Paul SternbergLincoln Stein Erich SchwarzTodd Harris Raymond LeeNansheng Chen Wen XiaoFiona Cunningham Sanger CenterWashington University Richard DurbinJohn Spieth Daniel Lawson Keith Bradman