1. Gene knockout Lecturer ： Du Shengyang January 24 2013

2. Minimum genome Based on a kind of ideal hypothesis It assume that cells contain a minimal gene set Under the condition of the gene set to maintain normal life functions reduced genome Gradually eliminate nonessential gene sequence

3. The significance of gene knockout Gene knockout can reduce the redundancy of biological system Identify specific essential genes Improve metabolic efficiency Controllability and predictability higher

4. nonessential genes and sequences recombinogenic or mobile DNA and cryptic virulence genes gene cluster related to different secondary metabolites synthesis IS sequence Redundancy sequence

5. The common method 1 、 homologous recombination 2 、 Insertion mutation 3 、 RNAi

6. Red recombination 1.red and Sce I cutting 2.Two step to Red recombination

7. Cre-LoxP System LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT ATAACTTCGTATA TATTGAAGCATAT Cre Target gene LoxP

8. a novel Bacillus subtilis strain,MBG874,depleted of 874 kb (20%) of the genomic sequence productivity of extracellular cellulase and protease from transformed plasmids harboring the corresponding genes is remarkably enhance d

12. a new genetic strategy based on the Cre-loxP recombination sy stem to generate large chromosomal rearrangements in Lactoc occus lactis. The Cre-loxP recombination system described can potentially be used for other gram-positive bacteria without further modific ation.

13. Chromosomal inversions in Lactocoaal

16. All inversions have an effect on the cell fitness compared to that associated with the corresponding isogenic parental structure, with a decrease in growth rate ranging from 8 to 18% depending on the extent of the chromosome disorganization it can potentially be used for generating rearrangements in any region of the bacterial chromosome.

17. It will be a powerful tool for purposes such as control of the copy number of integrated exogenous DNA in gene expression investigations or shuffling of the bacterial chromosome (by deletions or inversions) for applied and fundamental genome studies.

19. W3110ΔrecB CD::Plac-bet exo kan Confirm nonessential area and translocation genes, IS sequence by comparative genome comparing the genomes of W3110 and Buchnera sp. compare PEC and ERGO database determine the knock out area use red reorganization system of the phage λ B.subtilis GB469 Gain 11 nonessential gene cluster by prediction and experimental verification Using the upp-cassette and 5-FU screening method,it choose the area that a single gene knockout does not affect cell growth gene knock out gradually

20. Our subject Confirm the target that can be deleted In other hand, we can not affect the bacteria growth and nisin synthetic Using some Gene knockout techniques deletes IS sequence and gene cluster related to secondary metabolites synthesis.(upp or Cre-loxP ) Experimental verification and analysis