1. Division of Emerging and Transfusion Transmitted Diseases Bioterrorism Preparedness Initiatives Hira L. Nakhasi, Ph.D.

2. Division of Emerging and Transfusion Transmitted Diseases (DETTD) Mission Plans and conducts basic and applied research –development, manufacture, pathogenesis and testing of Viral (HIV, HTLV, hepatitis), Parasitic, Bacterial, potential BT agents and Transmissible Spongiform Encephalopathy agents or “prions”. Ensures the safety of Nation’s blood supply – by reviewing, evaluating and recommending actions PLAs, PMAs, INDs, IDEs, 510(k)s for blood screening and diagnostic testing for above mentioned agents. Develops and revises FDA Guidance for users of blood screening and diagnostic products.

3. Division of Emerging and Transfusion Transmitted Diseases (DETTD) Mission Performs lot-release testing for approval of investigational tests and of licensed products. Develops reference materials for lot-release testing. Performs inspections of manufacturers of licensed products, manufacturing facilities. Provides expert scientific and technical advice to other Agency and Government components. Presents issues related to the safety and efficacy of blood donor screening testing at the Blood Product Advisory Committee and TSE Advisory Committee meetings

4. DETTD Strategic Plan to Counter Terrorism- policy and regulation –Donor screening/suitability Agent exposure (diagnostic or detection) Emergency release of blood components –Product Release Exemptions –Testing Sensitivity and Specificity

5. Actions to protect the blood supply DETTD-Policy –Use of ongoing and proposed vaccine trials to define the period of viremia/ bacteremia after vaccination –Development of a plan to vaccinate repeat donors –Consider whether immunosupressed blood recipients should get IG or antitoxins with transfusion

6. Regulation Test kit performance: Specificity  Clinical -Donor populations, e.g. intended use for blood and plasma donor testing  Analytical -Other diseases -Interference

7. Regulation Test kit performance: Sensitivity  Clinical –Known positives and high risk populations –Seroconversion panels –Variants  Analytical –Endpoint dilutions –Well characterized reference materials (WHO and CBER standards) Reproducibility –multiple sites, operators, kit lots

8. DETTD Strategic Plan to Counter Terrorism Actions to Protect the Blood Supply - Research –Detection and donor screening Microarray technology Nucleic Acid Testing –Pathogen Removal/Inactivation Tests for Blood and Blood products Tests for Plasma Derivatives –Pathogenesis of BT agents in blood

9. Actions to protect the blood supply DETTD Research Plan- short range plan I. Devise donor screening methods and tests to assure that affected individuals do not spread bioterrorism agents. –Adapt previously established nucleic acid based tests to detect BT agents in blood. –Develop primers and possibly probes for fluorogenic-based PCR for BT agents. –Collaborate with other agencies to test our reagents in their systems. –Encourage industry to submit INDs for serologic and nucleic acid based tests for blood screening and diagnosis.

10. Common Gene Amplification Chemistry Reverse Primer 5’ 5’ 3’ 5’ 3’ Forward Primer RQ 5’ 5’ 3’ 3’5’ 5’ 5’ Q R 5’ 3’ Fluorescent reporter and quencher dyes covalently linked to olignucleotide probe Nucleic Acid Template Reporter dye released during amplification. Reverse Primer 5’ 3’ Forward Primer

11. Actions to protect the blood supply - long range plan II. Investigate experimental testing methodologies to facilitate evaluation of industry methods. –For detection of several agents simultaneously –Development of a DNA oligonucleotide microarray for detection of bioweapon agents such as Variola major (Smallpox), Filoviruses, Yersinia pestis (Plague), Francisella tularensis (Tularemia), Bacillus anthracis (Anthrax) in blood and blood product based on their potential for transmission by blood during the asymptomatic incubation period.

12. Microarray as a Blood/BT Agent Diagnostic Tool HIVTAGGAATACCACATCCCGCA HCVACCCCCCCTCCCGGGAGAGC Leishmania.CTTTCCCATCGCAACTTCGGT T.cruzi TTTTGGGAGGGGCGTTCAAA PlagueCTTTCCGTGAGAAGACATCC B. anthracisGAACTCAAGAAAAAAGCGA SmallpoxACGACTCTCCATACGATGAT Pathogen sequences from databases AGCAGC CGGCGG G C T G A Synthesize probes, Print on microchip Extract genetic material from blood or blood products HIV genotyping array ( Lipshutz et al., Nat. Gen., 1999) Amplify and label the target with multiple, pathogen-specific primers Hybridize to microarray (hypothetical result)

13. Actions to protect the blood supply DETTD Research Plan- long range plan III. Develop antiviral compounds against viral BT agents capable of neutralizing and preventing viral growth. For in-vitro inactivation of BT agents in blood and blood products

14. Small-molecule microarray microarray Binding of Binding ofRNA-polymerase Addition of purified RNA-polymerase RNA-polymerase Detection of binding by plasmon resonance plasmon resonance Screening of small-molecules that bind to the Ebola virus RNA-dependent RNA-polymerase

15. DETTD Strategic Plan to Counter Terrorism Outcome: Develop laboratory expertise in new technologies Utilize this expertise for evaluation of related submissions from industry Transfer technology for industry development Lot-release testing Understand the molecular mechanisms of pathogenesis of BT agents in blood