Presentation is loading. Please wait.

Presentation is loading. Please wait.

FilmArray: Automated PCR

Similar presentations


Presentation on theme: "FilmArray: Automated PCR"— Presentation transcript:

1 FilmArray: Automated PCR

2 Genetics In the Real World
How are genetics used in real world applications? What can an undergrad student do with knowledge gained from Biology?

3 PCR: A Quick Review Polymerase Chain reaction: Quiz: what do you know?

4 Components of PCR 5’ 3’ TCCACAGGCGCTATCTGCT AT C
Free nucleotides C C G A T Taq polymerase T Primer 5’ 3’ TCCACAGGCGCTATCTGCT AT C G AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA 3’ 5’ Template DNA Buffers

5 PCR Process -Heat denatures template strand
-Forward and reverse primers are annealed to single stranded DNA -Taq polymerizes dNTP’s to elongate the replicated strand.

6 PCR Amplification Original DNA Copy
5 cycles of PCR amplify 1 copy into 32………and so on

7 Instruments for Viewing PCR Results
Gel Electrophoresis and Camera image of agarose gel

8 PCR in the Classroom How long does PCR take?

9 Improving the Process: PCR today
New Concepts Biotechnology industry utilizes many new improvements in conducting and analyzing the PCR process

10 Fluorescent DNA: DNA Binding Molecules
GCAATCGTGTCATGTCTG = CGTTAGCACAGTACAGAC + GCAATCGTGTCATGTCTG CGTTAGCACAGTACAGAC Fluorescent molecules that bind to double stranded DNA help make it visible. Works like ethidium bromide in gel electrophoresis

11 Camera Records a Fluorescent Image Every Cycle
Visible Realm Greater Than 10 Billion Copies Number of DNA Copies PCR Cycle

12 Uses a camera and Software to plot fluorescence during PCR
Real-Time PCR Uses a camera and Software to plot fluorescence during PCR

13 Nested PCR Nested reaction includes: 1. outer PCR (PCR1) 2. dilution
3. inner PCR (PCR2) *allows for more specific amplification of selected organisms

14 Nested RT-PCR Primer Designs
Virus Genome Outer RT-PCR 200bp Inner PCR 90bp

15 Multiplex Assays Uses multiple primers in one reaction to
amplify several different DNA templates present in a sample i.e.: clinical sample run on a panel of 20 organisms to determine presence of infection

16 Schematic of Nested Multiplex PCR
Primary RT-PCR Secondary PCR 1F 1R 2F 2R 3F 3R 4F 4R 5F 5R 6F 6R Dilute 100 fold

17 Primer Design Primer of 17 base pairs has 1 in 10 billion chance of laying down on human genome. Design never goes below 17 bp (usually 18-20bp) AGGCGCTATCTGCT ATC 5’ 3’ AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA 3’ 5

18 Our Project: FilmArray

19 Collaboration Chemists: PCR reactions occurring in the pouch
Engineers: Pouch development and Instrument development Software: Communication from instrument to computer, analysis of data Film Array instrument allows for automated PCR with results in approximately 1 hour

20 FilmArray Pouch Pouch substitutes pipettes and tubes for mixing
Cell Lysis PCR1 PCR2 Mag Bead Capture Dilute Wash FilmArray Pouch Pouch substitutes pipettes and tubes for mixing substitutes chemist on a bench-top FLASH ANIMATION

21 FilmArray Beta Prototype
Substitutes mechanical actions of chemist and bench-top instruments (bead whacker=vortex, mag. beads and blisters=filter tubes and centrifuge, peltier=thermo block, array=DNA detection

22 Run Protocol DNA Melt Green indicates camera acquisitions:
2nd PCR 1st PCR Green indicates camera acquisitions: Once per PCR2 cycle 2500 in the 5 min melt There are two Peltier Thermocyclers The software displays the temperature during each PCR and the melt

23 Example of Results Software makes call, positive or negative result
PCR1 Control PCR2 Control Sc DNA assay Sc RNA assay Sp DNA Assay Sp RNA Assay 2nd PCR Post PCR Melt Software makes call, positive or negative result

24 Film Array Utilizes Faster Process
Sample utilization: 120 1uL reactions = 1/10 price Pre amplification (PCR 1= enrichment) amplifies enough to cover entire array every well Some micro-array processes have difficulty having enough sample for every well

25 Risks of PCR Contamination is a HUGE risk factor
Nesting not to popular because of how easily you can contaminate your assays False positives look the same as true positives The pouch is an all enclosed environment that eliminates the risk of contamination

26 Reagent Lyophilization
All reagents in the pouch or lyophilized (freeze dried) so all that is needed is water Freeze Dried reagents can have a shelf life of approximately 1 year Wet Bench Top reagents have short shelf life Proteins are protected with “cake” so they don’t die

27 Film Array Applications: Projects Under Development
Respiratory Panel: Clinical Samples Febrile Infant Risk Stratification Tool (FIRST): bacterial identification for infant fever Biothreat Pouch:Department of Defense Methicillin Resistant Staph. aureus detection:characterizing outbreaks of Staph infection in the hospital and community Tuberculosis Screening

28 Respiratory Panel Resp. Panel screens samples for 16 viruses or bacteria in 1 hour

29 Micro-array: Automated Pipetting

30 Spots Primers in specific layout

31 Kody (BioChemistry Intern)
Pouch Production Freeze Dry Reagents Reagent QC Primer Validation and Tracking Assay Optimization Pouch/Protocol Optimization Build and Update Database

32 Meghan (Research Associate I)
NanoPlotter validation and QC Film Array instrument optimization Assist with pouch production

33 Idaho Technology Broad range of projects
Great experience, resume builder Offers career opportunities, internships, and benefits Visit: Join the ITI Team                                                     

34 Questions?


Download ppt "FilmArray: Automated PCR"

Similar presentations


Ads by Google