1. SRY Gene on Chromosome Y Jon Scales Genetics Fall 2012 1 GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG M Q S Y A S A M 121 TTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAATATTCCCGCTCTC 9 L S V F N S D D Y S P A V Q E N I P A L 181 CGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAACG 29 R R S S S F L C T E S C N S K Y Q C E T 241 GGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATC 49 G E N S K G N V Q D R V K R P M N A F I 301 GTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCA 69 V W S R D Q R R K M A L E N P R M R N S 361 GAGATCAGCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCA 89 E I S K Q L G Y Q W K M L T E A E K W P 421 TTCTTCCAGGAGGCACAGAAATTACAGGCCATGCACAGAGAGAAATACCCGAATTATAAG 109 F F Q E A Q K L Q A M H R E K Y P N Y K 481 TATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAATTGCAGTTTGCTTCCCGCAGAT 129 Y R P R R K A K M L P K N C S L L P A D 541 CCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTACAGGGATGACTGT 149 P A S V L C S E V Q L D N R L Y R D D C 601 ACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACGCA 169 T K A T H S R M E H Q L G H L P P I N A 661 GCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGG 189 A S S P Q Q R D R Y S H W T K L * 721 GTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCA 781 CTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCA 841 TTTCA SRY Yp11 3 Figure 1. SRY is located at Yp11.3 just outside the pseudoautosomal region (PAR) of homology with the X chromosome. The SRY gene is lo- cated at physical position 2654900 - 2655000 bp and consists of a single exon. PAR Figure 3. SRY encodes a 845nt mRNA with an ORF of 615 bp (including stop) from nt 96-711 which encodes a 204aa protein. The SRY protein belongs to the HMG-box family of DNA binding proteins. Them amino acids comprising the HMG box (67-119) are indicated in red. The HMG box is shared among numerous proteins which are members of the SOX (SRY-box) family. Introduction SRY is encodes a transcription of the HMG-box family. SRY regulates male sexual development in mammals as shown in the pathway in Figure 2. Mutations in SRY are known to cause the condition gonadal dysgenesis. Persons with this condition are phenotypically female, but do not express female secondary sex characteristics. Identification of SRY Initially DNA from XX karyotype males was used to identify the breakpoints of Y chromosome sequences translocated onto the X chromosome. Once this region of the Y chromosome was identified, large regions of 10-25 Kbp were inserted into bacteriophage  vectors. A region of Y-specific DNA near the boundary of the pseudoautosomal region was found to detect Y-specific sequences in several species of mammals. This 2.1Kbp fragment of DNA also detected an mRNA transcript in testis but not other tissues. Expression of SRY SRY is expressed in a variety of tissues. During embryogenesis, it is expressed in the somatic cells of the genital ridge. In adults, expression is detected in the germ cells in the testis. Figure 4. There are homologs of SRY in all mammals. Here the schematic human and mouse proteins are aligned by their HMG boxes which are 89% identical. The mouse protein has a large region of glutamine repeats that is apparently dispensable as there is a nonsense mutation at the position of the asterisk in one strain which cause does not affect sexual differentiation. Figure 6. Mutations known to cause gonadal dysgenesis are indicated here. Note that the vast majority of these mutations occur within the HMG box which is the DNA binding domain of the protein. Figure 2. SRY sets in motion a chain of gene activations which give rise to male sexual development and simul- taneously block the development of female reproductive structures.. Figure 5. HMG-box containing transcription factors bind in the minor groove of the DNA double helix (pink). Binding in the minor groove induces a bend in the DNA. The HMG-box sequences form a series of 3 alpha helices (shown in green).