1. Lecture 3 Lecture 2 catch up Vector structure Copy number control
Selectable marker
Plasmid DNA isolation
ESTs
DNA sequencing
Entering the Honeybee database

2. How are different sizes of DNA strands separated on agarose gel?
Mixture of DNA
molecules

3. DNA separation is based on fragment size
Decreasing Size
(+)
(-)
PCR1
PCR2

4. Size markers and their use to determine size

5. Size markers and their use to determine size
Mobility of a DNA fragment is
proportional to the log of its
size in bases.

6. Plot of relative mobility of DNA vs log of size on semi-log graph paper

7. DNA Ladders Varying concentrations of agarose
How does one make a 0.7%, 1.0% & 1.5%
agarose gel?
Why are there varying concentrations
of agarose gels?

8. DNA Ladders Varying concentrations of agarose
Why are there varying concentrations
of agarose gels?
Higher concentrations provide better
resolution for smaller DNA fragments
Lower concentrations provide better
resolution for larger DNA fragments

9. Experiment 1 What is an EST?

10. pT7T3-pac

11. 3 important parts of a vector
Origin of replication
Selectable marker
Cloning sites

13. Origin of replication: considerations
What is an origin of replication?
Why do we need one?
What properties should it have for easy plasmid DNA isolation?

14. Replicon Contains all info necessary to begin and end DNA replication
Origin of replication (Ori) is a defined location within the replicon
where DNA synthesis begins

15. The ColE1 origin of replication

16. ColE1 origin RNAII forms the primer for initiation of DNA synthesis
RNAI and Rop protein are negative regulatory functions: RNAI binds to RNAII stopping primer formation; Rop protein stabilizes the complex formed by RNAI and RNAII.

17. The ColE1 origin of replication

18. RNAI:RNAII interaction

19. Rop protein negatively regulates the origin of replication by stabilizing the RNAI:RNAII interaction.

20. Copy number

21. Why does pT7T3.pac have a high copy number?
Point mutation in the origin that alters the initiation of RNAI transcription, such that the RNAI:RNAII complex does not form as well as wild-type.
The region of the origin that encodes Rop protein is deleted.

22. Selectable Marker Ampicillin resistance
Ampicillin is a penicillin derivative.
Blocks cross linking of the bacterial cell wall causing the cells to burst/lyse.
Ampicillin resistance gene encodes a secreted enzyme that cleaves the beta-lactam ring.

23. Benzyl penicillin
b-lactam ring

24. Mechanism of resistance

25. Plasmid DNA isolation Separate chromosomal DNA from plasmid DNA
Remove protein
Remove RNA
Easy

26. Starting material

27. Lysis and denaturation

28. Neutralization and centrifugation

29. Column Silica gel DNA binds at high salt. DNA is eluted at low salt.
Removes glycogen and other cellular components.

31. ESTs Expressed sequence tags? What are they? What do they represent?
What do we use them for?
What are their advantages?

32. How is cDNA made?
First strand synthesis
GCGGCCGCGTTGCTTTTTTTTTTTTTT 3’
3’ AAAAAAAAAAAAAAAAAAANNNNNNNNNNNN
Reverse transcriptase

33. Second strand synthesis
Remove mRNA with OH or enzymatically
DNA polymerase I
Cut hairpin
Add EcoRI adaptors GAATTCGGCACGAGG
Cut with NotI and insert into EcoRI NotI of vector

34. Normalized Library
mRNAs accumulate to different levels in a mRNA sample.
Normalization is a method of evening out the abundance levels
using hybridization.

35. T7 sequencing primer?

36. Dideoxy or Chain Termination Method
DNA SEQUENCING
Dideoxy or Chain Termination Method
1974
Maxam/Gilbert (USA) (Chemical Cleavage protocol)
Sanger (England) (natural process of DNA replication) *
Phosphodiester bond cannot form
with incoming nucleotides leading
to termination of DNA synthesis

37. Sanger Sequencing in 1989

38. Primer
ADD:

39. Example output

40. Why is the size of the insert important?
A sequencing run may only go bases.
What might you see and what might you not see?

41. EST gel

42. Clipping an EST sequence
What are we clipping out?
Why do we look for GAATTCGGCACGAGG and GCAACGCGGCCGC?
Why do we look for AAAAAAn?

43. AAAAAAAAAAAAAAAAAAAAAAAA
Example
GAATTCGGCACGAGG
CGCGTTCTTGAAAAGACAGGTAAAATGCGAGTTCCAGAATGGGTAGAATTGTAAAGTCTGCACGATTCAAGGAACTTGCTCCATATGATCCAGATTGGTATTATATTAGATGTGCTGCTTTAGTTCGTCATATTTATATTCGAAGTCCAATTGGTGTTGGAGCAGTAACAAAAATTTTTGGAGGACGCAAACGTAATGGTACTCATCCTAGCCATTTCTGTCGATCGGCAGGTGGTGTTGCTCGCAAAGCTCTTCAGAGCTTGGAACAACTTAAACTCATTGAAAAATCTCCAGTTGGTGGACGTAAACTTACCAGTCAAGGCCGTAGAGATTTAGATCGCATTGCTGCCCAAGTCAAAGCAAAAAGCAAAAAACAACTTAAGTTACAAGAAACTCTTGTTCTCTAATTTCTTTATTTCTATAATAAAAATTAAAAAATCGTACATTTATATTCAAATTTTATTTATTCTACTATTATAAGTTAATTTTAGAAGTCTTAAATAATTTAATGGTAACAAAATATCACAAGACAATGTGCTATTATTTTTTTAATTGTTTATGAATTATCATAATTGAGGAAATTTTTAACTATAAATAGATAAAGTAAGAAATATAAATTTATAATTTATGATTATGTATTTTATATCTAAATGTATTTATTAATCTAAATATAAACAAATATACAT
AAAAAAAAAAAAAAAAAAAAAAAA
GCAACGCGGCCGC
AAGCTTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTC

44. Example output

45. What could go wrong 18% of ESTs are in the reverse orientation.
Potential of 2 inserts in the clone.
What would this look like?

46. Step into liquid

47. Clipping a sequence I

48. Clipping Sequence II

49. Clipping Sequence III

50. Clipping Sequence IV

51. Step into liquid