1. Next Generation DNA Sequencing Platforms: Evolving Tools for
Cancer Research
Norma Neff
Bioengineering / Quake Lab
Sequencing Core Director
Stem Cell Institute
SIM1 G1115 / G0821

2. Single Molecule Sequencing Technologies
Sequencing By Synthesis
Emulsion PCR-based Sequencing Technologies
Sequencing Technologies
Single Molecule Sequencing Technologies
Recommended Reviews:
Michael Metzker (2010) Nature Reviews Genetics 11:31
Quail et al (2012) BMC Genomics Jul 24;13:341.

3. Outline of Today’s Presentation: Sequencing by Synthesis
Next Gen Sequencing Sample or Library Preps
Review of Seq Technologies
Comparisons of Different Platforms
Summary and Final Thoughts

4. Design of Sequencing Samples or Libraries
Adapters are Ligated to Sample DNA to be sequenced = Library
Adapters are short (30-50bp) double-stranded oligos
Sequences of the adapters are specific to each seq platform A1 A2
Sites for PCR primers to bind to amplify the Library A1 A2
Sites for seq primers to bind to seq the sample DNA A1
BC1 A2
BC2
Bar codes (6-12bp) for multiplexing libraries in a seq run

5. Sequencing by Synthesis:
Bases are added to DNA Molecules at the 3’ OH end of the Chain
3’ OH

6. Emulsion PCR – Library DNA is amplified in an Oil Droplet
Beads are spun into wells on a plate
Flows one dNTP at a time
Detects PPi Release
By Coupled Luciferase Rxn
Light Intensity = Base addition
Beads are spun into wells of chip
Flows one dNTP at a time
Detects H+ Release
pH change = Base addition

7. Roche 454 Benchtop Sequencers – 400bp Readlengths / Reliable Chemistry
Requires most time from Library to Machine Loading
First Technology to Incorporate Bar Coding of Libraries
Roche 454 GS FLX+ Titanium
GS Junior
Output = 1 Millions Reads; Mb
Read Length = 400bases (700bases)
Run Time = 8-23 hours
Error Profile = Indels Homopolymers
Output = 70k-100k Reads; 30Mb
Read Length = 400 bases
Run Time = 10 hours
Error Profile = Indels Homopolymers

8. Ion Torrent = Desktop Sequencers for Low and High Sequence Output
PGM
Output M bases
Read Length = 200 bases
Run Time = 1-3 hours
Error Profile = Indels
Homopolymers
Output 10 G bases
Read Length = 200 bases
Run Time = 4 hours
Error Profile = Indels
Homopolymers
Ion Proton I
Coming soon:
Proton II and III
base reads

9. X X O O O H O O O O O- O- O- OH H O O O H O O O O O- O- O- H H N3 O O
Adenosine 5’ H O O P O P O P
dATP vs ATP 2’ O- O- O- 3’ OH H O O O
Adenosine 5’ H O O P O P O P
ddATP vs dATP 2’ O- O- O- 3’ H H
Irreversible Terminator
Sanger Sequencing X N3 O O O O
Adenosine 5’ H O O P O P O P 2’ O- O- O- X 3’ O H
Reversible Terminators
& Cleavable Fluorescent Tags N3

10. Solid Phase Amplification – Library DNA binds to Oligos
Immobilized on Glass Flowcell Surface
Clusters are Linearized
Seq primer annealed
All four dNTPs added at each cycle
Error Profile = substitutions
Each dNTP has a different
**Fluorescent Tag**
Intensity of different Tags = Base call
V3 HiSeq

11. Evolution of Solexa / Illumina Sequencing Platform
GA II (2006)
HiSeq 2000 (2010)
Output Gb / lane
Read Length = 100 bases SR
Or 2x100 PR
Accommodates Dual Bar codes
Run Time = 2-14 days
Error Profile = substitutions
HISeq 2500 = 2x150 (2x250)
600 million reads / 39 hours
Output 1 million 1x36bp reads / lane
Improved chemistry to 10 million / lane
Paired end reads to 2x150bp V3

12. MiSeq – QC Libraries and 250bp Reads
V1 Runs 1x50bp + I or 2 bar codes (6 hrs)
2x150bp + bar codes (28 hrs)
10M reads = 1G bases
V2 Runs – Use Top and Bottom of Lane
2x250bp + bar codes (39 hrs)
15M reads = 7G bases
Accommodates Dual Bar Codes
Uses single reagent cassette and buffer bottle
Same paired end libraries on all Illumina seqs
Has additional options for Base Space data
storage system and alignment software
Real time run monitoring and data sharing
MiSeq
V3 HiSeq

13. Single Molecule Imaging: Heavy Metal Battle Royale
Short Reads & High Output vs Long Reads & Low Output

14. Helicos Genetic Analysis System
HeliScope™
Analysis
Engine
HeliScope™
Sample Loader
Oligo dT on Flowcell
>GATAGCTAGCTAGCTACACAGAGAT
>GATAGACACACACACACACAGCGCA
>GTACTACACACAGCGACACAGTCTA
>GTCGAACACACATGAACACATGAGC
>GTGTCACACACGACTACACATGCAT
>TAGTGACACACGTAGACACGACAGT
>TCTCGACACACTATCACACGACTCA
>TGCACACACACTCGTACACGAGACG
Output
20Tb
Sample
Preparation
dA Tailing TdT
600 – 900
Million Aligned
Bases per lane
X 50 lanes
Does not use
ligation or PCR
amplification
HeliScope™
Single Molecule
Sequencer
33bp Avg Reads; Gb; 8 day Run
Use Terminal transferse to add poly dA tail
Flows one nucleotide at a time – Error Profile = Indels
DNA quality not an important factor – ancient DNA
Can do Direct RNA Sequencing – 3’ ends
Custom Seq Capture Flowcells
Primarily a sequencing service company 14
Company Confidential

15. Pacific Biosciences RS:
Real Time Movies of Nucleotide-binding by DNA Polymerase
Adapter
Subreads
Mapped Read Length

16. PacBio Technology Makes Base Calls on How Long the Base Stays in the Active Site
Output = 50k Reads; 100 Mb per SMRT Cell (16 max per run)
Read Length = 2000 bases
Run Time = 90min per SMRT Cell
Error Profile = Indels

17. Mean Mapped Readlength Mean Mapped SubRead Accuracy
Update of PacBio Progress 2011 – 2012
Year
Mean Mapped Subread
Mean Mapped Readlength
Mapped Reads per Cell
Mean Mapped SubRead Accuracy
Mapped bases per cell
Movies per SMRT cell
Max Time per Movie
Strobe Seq
2011
470bp
550bp
14k
85%
5Mb 1
30min
yes
2012
675bp
1914bp
48k
89%
92Mb 2
90min no

18. Cost of $equencing Reagents Library Construction Quality Assessment
Accessory Equipment and Supplies
Labor to get samples on the machine
Machine maintenance / service contracts
Computational Requirements
Data Storage
Technology
Run Type
Est Cost / MB
Roche 454
Full Plate 400bases
$30
Ion Torrent PGM
316 chip 200bases $3
Illumina HiSeq
2x100 bases
$0.01
Illumina MiSeq
2x150 bases $2
PacBio
45,000 / 90min cell
$0.20

19. Two Strategies for Sequencing: Depth of Coverage vs Speed
Depth of Coverage ( million reads with good quality scores) = Discovery vs
Speed (1-24 hours run time) = Validation and Diagnosis
Accuracy / Seq Error Profiles / Bioinformatic Tools

20. Summary and Final Thoughts
Sequencing Technologies Keep Evolving
Plan your sequencing experiments based on the data set you need
Consider size of data set, accuracy reads, cost and speed
Choose your platform appropriately
Work smarter – be imaginative and what seems impossible today
can be the standard tomorrow