1. DNA Transcription and Translation
Sections 12.3 and 12.4

2. Do Now 1. What is RNA? 2. What are proteins used for in our bodies?
3. Fill in the chart below:
DNA
RNA
Structure
Sugar
Base
Example strand: Complimentary:
TACGA

3. Gene Segment of DNA that codes for a protein
The Central Dogma of Biology:
DNA codes for RNA and RNA makes protein (the synthesis of)

4. One Gene – One Enzyme
The Beadle and Tatum experiment showed that one gene codes for one enzyme.
One gene codes for one polypeptide.
polypeptide - a chain of covalently bonded amino acids.
(proteins are made of one or more polypeptide)

6. Let’s make some observations about RNA’s structure

7. RNA RNA stands for: RNA is found: Ribonucleic acid
Nucleus and Cytoplasm

8. RNA Structure
Like DNA, RNA is made up of subunits called _____________, which are made of three parts:
Sugar (ribose)
Phosphate
Nitrogen Base

9. RNA’s Nitrogen Bases
Adenine (A)
Cytosine (C)
Guanine (G)
Uracil (U)

10. There are 3 types of RNA:
Messenger RNA (mRNA) – long strands of RNA nucleotides that are formed complementary to one strand of DNA.
Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes.
Ribosomal RNA (rRNA) – associates with protein to form the ribosome.

11. All RNA is …
Single stranded
Many different shapes
“Cheap copy” of DNA

13. Do Now 1. What is a protein made of?
2. Explain the process between DNA and proteins.

14. Transcription First step in making proteins
Process of taking one gene (DNA) and converting into a mRNA strand
DNA -> RNA
Location:
Nucleus of the cell

16. Steps to Transcription
1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA

17. Steps to Transcription (Cont.)
2. One strand acts as a template.

18. Steps to Transcription (Cont.)
3. A mRNA copy is made from the DNA template strand by RNA polymerase
4. A mRNA copy is made until it reaches the termination (stop signal) sequence
5. The two strands of DNA rejoin.

19. Template vs. Non Template Strand

22. Transcription animation

23. Transcribe this DNA to mRNA

25. mRNA Processing
Pre-mRNA – the original sequence of RNA created during transcription
mRNA reaches the ribosomes

26. RNA Processing

27. What is RNA Processing?
After transcription the pre-mRNA molecule undergoes processing
5’ cap is added
Poly A tail is added to the 3’ end
Introns are removed.

28. Do Now
Label the Transcription diagram

29. RNA Processing In Eukaryotes only Introns- non-coded sections
Exons- codes for a protein
Before RNA leaves the nucleus, introns are removed and exons are spliced together
A cap and poly A tail are added to ends of the sequence
mRNA leaves the nucleus through the nuclear pores

30. Why is it necessary to add the poly A tail and 5’ cap?

31. Let’s try an activity (11.5)
ducts/ /index.html

33. Pg. 339
Pg. 339

34. Let’s an example… 3’ CAUGAUGUACGAUACGUA 5’
Original DNA Sequence (DNA):
5’ GTACTACATGCTATGCAT 3’
Translate it (RNA):
3’ CAUGAUGUACGAUACGUA 5’
Add the 5’ cap:
3’ CAUGAUGUACGAUACGUA 5’
cap

35. Finish the job! Add a poly A tail onto the 3’ end
Remove the introns “UGUA” and “AUAC”:
3’ CAUGAUGUACGAUACGUA 5’
cap
3’ CAUGACGGUA 5’
cap
Add a poly A tail onto the 3’ end
3’ CAUGACGGUA 5’
cap
Poly A tail

36. Get a new partner! DNA Strand of non-template strand:
5’ ATCGGTAGAGTATTTACAGATA 3’
Remove introns:
CGGUA UUACAG

37. Think, Pair, Share
Take a minute think on your own, then pair with your partner, and share your ideas!
Evolutionary, why do you think there are introns?
Where did they come from?
Why do we have them?
Remember there is NO wrong answer!

38. PROTEINS!

39. Proteins are made up of amino acids!!!
Proteins are polymers of amino acids
Only 20 different amino acids
BUT there are hundreds of thousands of different proteins
How can this be?

40. Let’s compare to it to the English language
How many letters are in the alphabet?
A,b,c,d,… 26
How many words are there?
Miss, Ings, is, smart, ..
Almost infinite!
Each word has a unique structure of letters.
Similar to proteins and amino acids

41. Proteins- (PCFNa) -made of 20 different Amino Acids
- Amino Acids bond to form polypeptide chains

42. How do amino acids form these peptide chains?
Peptide Bonds – Link each amino acids together to form proteins

43. How many amino acids are in a dipeptide chain?
How about a tripeptide chain?
How many water molecules are formed from 2 amino acids?
How many water molecules are formed from 100 amino acids?

44. Do Now Perform transcription on this DNA segment: GCTTCATACGA
Do RNA processing and remove the introns: GAA and UGC
How does this mRNA sequence leave the nucleus?
Where does it go?

45. Protein
Structure

47. Translation Production of proteins from mRNA
mRNA goes to the ribosomes in the cytoplasm or the RER and produces proteins

49. Steps to Translation
1. mRNA leaves the nucleus and binds to a ribosome
2. the 5’ end of mRNA binds to ribosome

50. Ribosome Two subunits to the ribosome
3 grooves on the ribosome (A, P, E)
A: tRNA binding site
P: polypeptite bonding site
E: exit site

51. Steps to Translation (Cont.)
3. Ribosome looks for the start Codon (AUG)
Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)

53. Steps to Translation (Cont.)
4. Amino acids attached to a tRNA molecule and are brought over to the mRNA.
5. This tRNA has an anticodon that matches the codon on the mRNA strand
Anticodon:
Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)

54. tRNA

55. Think-Pair-Share
The mRNA sequence reads the following codons: What amino acids do they stand for?
AUG
GGA
GAG
CAA
** What amino acid does the anticodon CGU stand for?***

56. Steps to Translation (Cont.)
6. tRNA binds to the mRNA sequence and adds an amino acid
7. Each amino acid matches up with 1-6 tRNA molecules
8. tRNA leaves and amino acids bond together through a polypeptide bond

57. Think – Pair - Share
Find the amino acid sequence for the following mRNA sequence (translation)
AUGCGACGAAUUUAA

59. Translation Animations
class.unl.edu/biochem/gp2/m_biology/animation/gene /gene_a3.html
olgenetics/translation.swf

60. Steps to Translation (Cont.)
9. The mRNA sequence continues until a stop codon is reached.
10. The amino acids disconnect from the mRNA sequence and a protein is formed.

62. Think-Pair-Share
Get with a partner, one partner transcribes and the other translates.

63. Do Now Do transcription on this DNA sequence: CGTACGCTCCCTAGACTA
Do Translation- Remember to start the right place!

64. Do Now Do transcription on this DNA sequence: TTTTATACTGAGGGTTAACTCGT
Do Translation- Remember to start the right place!

67. 1. 2. 3.

68. 4. 5. 6.

69. 1. Initiation
The two ribosomal subunits come together with the mRNA and the first tRNA molecule which attaches to the start codon (AUG).
This is the only tRNA that will attach to the P site.
The first amino acid is always methionine.

70. 2. Codon Recognition
The tRNA anticodon will hydrogen bind to the mRNA codon in the A site.

71. 3. Bond Formation
The amino acid in the P site will form a peptide bond with the amino acid in the A site.

72. 4. Translocation
The tRNA's and the mRNA move down one site. The empty tRNA is released from the exit site.

73. 5. Repeat
This process will repeat hundreds of times.

74. 6. Termination
Translation is terminated with the stop codon is reached. There are three different stop codons UGA, UAA, UAG.
The release factor recognizes the stop codon and releases the polypeptide strand. All the factors break apart and are reused.

76. Do Now
Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA).
Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop
What do you notice about your DNA sequences?

77. Do Now Template strand of DNA: 5’ TTACGGCTAGGAGTAGCCGAATTCTG 3’
Remove the introns: CUCAUC
Determine protein sequence

78. Do Now

80. How do cells know what protein to make when?
Gene Regulation: ability of an organism to control which genes are transcribed.

81. Controlling Transcription
Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts
The complex structure of eukaryotic DNA also regulate transcription.

82. HOX Genes Everyone develops from a zygote Zygote undergoes mitosis
Cell differentiation: cells become specialized
Certain gene sequences determine cell differentiation

83. HOX Genes Homeobox Genes (Hox Genes) are sequences of DNA
Hox genes are responsible for the general body pattern of most animals.

84. HOX Genes
Are transcribed at specific times, and located in specific places on the genome
Mutations:

85. Telephone We are going to play the game telephone.
Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)

86. Mistakes in DNA Cell make mistakes in replication, and transcription
Most often these mistakes are fixed
EX.

87. Mutations
A permanent change that occurs in a cell’s DNA is called a mutation.
Three types of mutations:
Point mutation
Insertion
Deletion

88. Point Mutation Substitution: A change in just one base pair
Missense Mutation: amino acid is change
Nonsense Mutation: amino acid is changed to a stop codon

89. Frameshift Mutations
Causes the reading frame to shift to the left or the right
Insertion: Addition of a nucleotide
Deletion: Removal of a nucleotide

91. ACGAAATACAGACAT Decide what type of mutation occurred: ACGAAATAGAGACAT
ACAAATACAGACAT
ACGAAATACAGGACAT

93. Causes of Mutations Mutations can happen spontaneously
Mutagens: Certain chemicals or radiation that can cause DNA damage
Causes bases to mispair and bond with the wrong base
High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.

94. Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring

97. Chromosomal Mutations
Piece of chromosome can be broken off, duplicated, or moved to another chromosome

98. Fragile X Syndrome Repeat of CGG about 30 times
Causes mental and behavior impairments

100. Protein Folding and Stability
Substitutions also can lead to genetic disorders.
Ex. Sickle Cell Anemia (caused by a substitution mutation)
Can change both the folding and stability of the protein

101. Sickle Cell Anemia

102. Causes of Mutations Mutations can happen spontaneously
Mutagens: Certain chemicals or radiation that can cause DNA damage
Causes bases to mispair and bond with the wrong base
High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.

103. Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring