1. Overview of telomeres & telomerase biology: Clinical implications in cancer and aging
Meir Lahav MD
Laboratory for telomere research, Rabin Medical Center, Beillinson Campus
Felsenstein Medical Research Center
8 March 2010

3. Historical perspective
1908, McClintock & Muller
“Chromosome bore a special component at their ends that provided stability”
Telomere: telos- end, meros- part
1961, Hayflick & Moorehead
“Normal somatic cells have a limited life span- a status that is terminated in M1 stage- replicative senescence”.
Leonard Hayflick

4. Biological landmarks 1971, Olovnikov:
“Marginotomy”- the end-replication
problem may account for the Hayflick
limit
1972, Watson:
DNA polymerase could not replicate
chromosomes to the tip

5. The end-replication problem
5’ ’
3’ ’
DNA Replication
R R R R R
RNA primer removal
Fill-in DNA replication
Ligation
Each division bp loss

6. Biological landmarks (cont.)
1978, Blackburn
discovered telomeres in
Tetrahymena
(TTGGGG)n
1984, Blackburn & Greider
telomerase activity
was detected in

7. Telomeric end of DNA
Genomic DNA Telomere

8. Molecular structure of the telomere

9. Functions of telomere [(TTAGGG)n]
Protects the chromosomal ends from:
Recombination
End-to-end fusion
Recognition as damaged DNA
Enables a complete replication of the DNA
Contributes to the functional organization of chromosomes in the nucleus
Participates in regulation of gene expression
Serves as “mitotic clock”: shortens with each cell division

10. Telomere length in healthy population Uziel et al. 2002

11. Consequences of telomere shortening & damage

13. Two-step hypothesis of cellular senescence and immortalization
Two-step hypothesis of cellular senescence and immortalization Wright & Shay Microbiol Mol Biol Rev 2002

14. Telomerase Telomerase hTERT hTR-CAAUCCCAAUC 5’ TTAGGGTTAG CAAUCCCAAUC
5’ TTAGGGTTAGGGTTAG
5’ TTAGGGTTAGGGTTAGGGTTAG
Telomerase
hTERT
hTR-CAAUCCCAAUC

16. Keeping telomerase in its place Maser & DePinho Nature Medicine 2002

17. The telomere model for cellular transformation
Germ cells: telomerase ON
Somatic cells:
telomerase OFF
Telomere length
Immortal cells:
telomerase ON
Oncogenetically
transformed cells:
bypass senescence,
telomerase OFF
Senescence Crisis
# of cell divisions

18. TRF measurements Shapiro, Uziel and Lahav 2000
Southern blot FISH flow

19. FISH on paraffin embedded tissues

21. Clinical applications of telomere research

22. Acquired capabilities of cancer
(Hanahan and Weinberg, Cell 100: 57-70, 2000)

23. Minimal set of genetic alterations required for conversion of fibroblasts to cancer cells Sun et al 2006
Malignant conversion:
SV40 large T antigen (p53 and pRb inactivation)
Ras activation
Malignant cells are not immortal - enter crisis and die
Telomerase expression renders cell immortal

24. Telomerase up-regulation cause or consequence
Human cancer cells have
shorter telomeres then normal
dysfunctional telomeres (anaphase bridges, ends fusions etc.,)
Correlation between anaphase bridges and telomere length
Human colorectal cancers show a peak in anaphase bridges index in early lesions;

26. Effect of telomerase inhibition on malignant cells growth

27. Telomerase inhibition in cancer Lahav 2010

28. Chemosensitization by telomeres Lahav 2009

29. Comet assay DNA damage Lahav 2010

30. DNA damage focci telomere dysfunction Lahav 2009

31. Association of telomerase activity with disease free survival in non-small cell lung cancer Gonzalez-Quevedo, R. et al. J Clin Oncol. 2002;20:

32. Thalidomide downregulates telomerase promoter gene expression molecular pharmacology Druker, Uziel, Lahav et al molec pharmacol
ARH-77
hTERT
IGFI-R
CD63
b actin
[ThD] mg/ml
RPMI U266
hTERT
IGFI-R
b actin
CD63
[ThD] mg/ml
hTERT
IGFI-R
CD63
[ThD] mg/ml
b actin

33. Telomerase activity after Gleevec 5 days treatment
Gleevec inhibits telomerase activity in SK-N-MC cells Uziel and Lahav,2005 BJC
0mM mM mM R8
Inhibition range: 70-90%
Telomerase activity after Gleevec 5 days treatment
Kinetics of telomerase activity during
Gleevec treatment

34. Telomerase cellular localization in STI571 treated cells
Telomerase cellular localization in STI571 treated cells Uziel, Beery et al 2003
Control cells STI571 treated cells

35. Telomerase as a drug target
Significant difference of telomerase expression between malignant and normal tissues
Possible adverse effects: damage to stem and germ cells
Telomerase inhibitors will be effective only when the telomeres shorten to critical length
Will probably be used as an adjuvant therapy

36. Potential effects of telomerase inhibition over time on telomere length and proliferative capacity Experts reviews in molecular medicine 2002

37. Strategies for inhibition of telomerase activity
Telomerase targeting agents:
The RNA template
Reverse transcriptase inhibitors
Modulators of telomerase regulating proteins
Telomeres targeting agents
Inhibitors that interact with G4-DNA structures
Inhibitors against telomeres associated proteins
“Old” DNA -interacting drugs
compounds from random screening

38. Effect of telomerase antisense on malignant cell culture Uziel and Lahav, 2004

39. Antimetastatic effects of GRN163L on pretreated A549-Luc cells Dikmen, Z. G. et al. Cancer Res 2005;65:

40. Telomere attrition sensitize SK-N-MC cells to DNA SS breaks inducing agent, Cisplatinum Uziel and Lahav, 2006
Control
+GRN163

41. Telomerase inhibition – future directions
New effective inhibitors
Antitelomerase vaccines
Antitelomerase adoptive immunotherapy
Promoter driven therapy
Development of antitelomerase – cytotoxic drugs – other biologic interventions combinations

42. Telomerase promoter-driven gene therapy
hTERT promoter is highly active in cancer cells (not active in somatic cells)
Expression of harmful genes under the control of hTERT promoter- expression directed to malignant cells
Genes used
Proapoptotic genes: caspase 8, caspase 6, TRAIL, Bax
Prodrugs
Viral lytic genes: adenoviruses

43. Adenovirus and telomerase promoter

44. Telomerase immunotherapy
Immunizing patients against tumor antigens to elicit antibody or cytotoxic T-cells killing of tumor cells
T cells against a short hTERT peptide in vitro and in mouse models in vivo; Somatic cells are not affected
Prostate or breast cancer patients were vaccinated with cells expressing tert peptide; 4 responded; No se.
12 prostate cancer patients were treated as above, majority responded positively

45. Aging
Aging

46. Comparison between a single homologue from one individual and a single homologue from an unrelated individual carrying the same genetic marker

49. Dolly or failure of resetting the cellular clock Willmut et al, 1997

50. Telomere length & survival rate

51. Trans-differentiation of pluripotent stem cells

52. Telomerase effect on cells

53. Telomere binding defect in progeria

54. Diabetes control and telomeres Lahav 2006

61. Translational applications ;
Cancer; Mechanism of malignancy
Therapeutic approaches
Aging; Cellular ( stem cells)
Organism ; normal
accelerated aging