Transcription Chapter 8.

Transcription Chapter 8

DNARNAProtein The Problem
Information must be transcribed from DNA in order function further. REMEMBER: DNARNAProtein

Tanscription in Prokaryotes
Polymerization catalyzed by RNA polymerase Can initiate synthesis Uses rNTPs Requires a template Unwinds and rewinds DNA 4 stages Recognition and binding Initiation Elongation Termination and release Polymerization catalyzed by RNA polymerase Can initiate synthesis Uses rNTPs Requires a template Template recognition RNA pol binds to DNA DNA unwound 4 STAGES Initiation—Chains of 2-9 bases are synthesized and released Elongation RNA pol moves and synthesizes RNA Unwound region moves Termination RNA pol reaches end RNA pool and RNA released DNA duplex reforms

RNA Polymerase 5 subunits, 449 kd (~1/2 size of DNA pol III)
Core enzyme 2  subunits---hold enzyme together --- links nucleotides together ’---binds templates ---recognition Holoenzyme= Core + sigma 5 subunits, 449 kd (~1/2 size of DNA pol III) Core enzyme 2  subunits---hold enzyme together --- links nucleotides together ’---binds templates ---recognition Holoenzyme= Core + sigma

RNA Polymerase Features
Starts at a promoter sequence, ends at termination signal Proceeds in 5’ to 3’ direction Forms a temporary DNA:RNA hybrid Has complete processivity Starts at a promoter sequence, ends at termination signal Proceeds in 5’ to 3’ direction Forms a temporary DNA:RNA hybrid Has complete processivity

RNA Polymerase X-ray studies reveal a “hand” Core enzyme closed
Holoenzyme open Suggested mechanism NOTE: when sigma unattached, hand is closed RNA polymerase stays on DNA until termination. X-ray studies reveal a “hand” Core enzyme closed Holoenzyme open Suggested mechanism NOTE: when sigma leaves, hand is closed RNA polymerase stays on DNA until termination.

Recognition Template strand Coding strand Promoters
Binding sites for RNA pol on template strand ~40 bp of specific sequences with a specific order and distance between them. Core promoter elements for E. coli -10 box (Pribnow box) -35 box Numbers refer to distance from transcription start site Template strand-complementary to transcript Coding strand-DNA version of transcript Promoters Binding sites for RNA pol on template strand ~40 bp of specific sequences with a specific order and distance between them. Core promoter elements for E. coli -10 box (Pribnow box) -35 box Numbers refer to distance from transcription start site NOTE The two strands can contain different genes or sets of genes but only one serves as the template strand at a time.

Template and Coding Strands
Sense (+) strand DNA coding strand Non-template strand DNA template strand antisense (-) strand 5’–TCAGCTCGCTGCTAATGGCC–3’ 3’–AGTCGAGCGACGATTACCGG–5’ transcription NOTE Both strands can contain info for transcription 5’–UCAGCUCGCUGCUAAUGGCC–3’ RNA transcript

Typical Prokaryote Promoter
Consensus sequences Pribnow box located at –10 (6-7bp) -35 sequence ~(6bp) Consensus sequences: Strongest promoters match consensus Up mutation: mutation that makes promoter more like consensus Down Mutation: virtually any mutation that alters a match with the consensus Pribnow box located at –10 (6-7bp) -35 sequence ~(6bp) Consensus sequences: Strongest promoters match consensus Up mutation: mutation that makes promoter more like consensus Down Mutation: virtually any mutation that alters a match with the consensus

In Addition to Core Promoter Elements
UP (upstream promoter) elements Ex. E. coli rRNA genes Gene activator proteins Facilitate recognition of weak promoter E. coli can regulate gene expression in many ways UP (upstream promoter) elements—Found in some very strong promoters. Ex. E. coli, in rRNA genes, see near consensus -35 box, perfect -10 box, but between 40-60nt upstream, see a sequence that stimulates transcription 30X Gene activator proteins Facilitate recognition of weak promoter

Stages of Transcription
Template recognition RNA pol binds to DNA DNA unwound Initiation Elongation RNA pol moves and synthesizes RNA Unwound region moves Termination RNA pol reaches end RNA pol and RNA released DNA duplex reforms Template recognition RNA pol binds to DNA DNA unwound Initiation—Chains of 2-9 bases are synthesized and released Elongation RNA pol moves and synthesizes RNA Unwound region moves Termination RNA pol reaches end RNA pool and RNA released DNA duplex reforms

Transcription Initiation
Steps Formation of closed promoter (binary) complex Formation of open promoter complex Ternary complex (RNA, DNA, and enzyme), abortive initiation Promoter clearance (elongation ternary complex) First rnt becomes unpaired Polymerase loses sigma NusA binds Ribonucleotides added to 3’ end Formation of closed promoter (binary) complex Formation of open promoter complex—Pol unwinds small region from +3 to -10 nt. Region generally high in A-T. Once open complex is formed, RNA pol ready to initiate synthesis. NOTE: RNA pol contains two binding sites, initiation and elongation. Initiation pocket favors purines, usually first rNTP brought in (first base in DNA is T or C). Elongation site is then filled with the next rNTP. RNA pol moves along, maintaining stretch of ~13 bases. Ternary complex (RNA, DNA, and enzyme), abortive initiation. RNA pol stalls, makes several small transcripts tha fall off. Eventually extends chain, escapes promoter. Promoter clearance First rnt becomes unpaired Polymerase loses sigma NusA binds—NusA is a protein that assists in elongation RNA polymerase holoenzyme scans DNA and pauses at promoter region. DNA is double helical (closed complex) RNA polymerase unwinds a bp DNA region (open complex). This creates (+) supercoiling downstream and (-) supercoiling upstream of the RNA polymerase. Initial 8 – 9 nucleotides are polymerized before the sigma factor is released. The first base is either pppA or pppG.

Closed (Promoter) Binary Complex Open binary complex
Holoenzyme Core +  Closed (Promoter) Binary Complex Open binary complex Ternary complex Promoter clearance Back

Sigma () Factor Essential for recognition of promoter
Stimulates transcription Combines with holoenzyme “open hand” conformation Positions enzyme over promoter Does NOT stimulate elongation Falls off after 4-9 nt incorporated “Hand” closes Essential for recognition of promoter RNAP only binds to specific sequences (promoters) with tight affinity when the sigma factor joins it to form the RNAP holoenzyme Stimulates transcription Combines with holoenzyme “open hand” conformation Positions enzyme over promoter Does NOT stimulate elongation Falls off after 4-9 nt incorporated. Can then nbind to other RNA pol. “Hand” closes

Variation in Sigma Variation in promoter sequence affects strength of promoter Sigmas also show variability Much less conserved than other RNA pol subunits Several variants within a single cell. EX: E. coli has 7 sigmas B. subtilis has 10 sigmas Different  respond to different promoters Variation in promoter sequence affects strength of promoter Sigmas also show variability Much less conserved than other RNA pol subunits Several variants within a single cell. EX: E. coli has 7 sigmas B. subtilis has 10 sigmas Different  respond to different promoters The presence of alternate sigma factors provides the cell with a mechanism for turning on and off entire families of genes under different circumstances

Sigma Variability in E. coli
Sigma70 (-35)TTGACA (-10)TATAAT Primary sigma factor, or housekeeping sigma factor. Sigma54 (-35)CTGGCAC (-10)TTGCA alternative sigma factor involved in transcribing nitrogen-regulated genes (among others). Sigma32 (-35)TNNCNCNCTTGAA (-10)CCCATNT heat shock factor involved in activation of genes after heat shock. POINT: gives E. coli flexibility in responding to different conditions Sigma70 Primary sigma factor, or housekeeping sigma factor. One we have discussed in most detail. Encoded by rpoD . When bound to RNAP Core allows recognition of -35 and -10 promoters. No other factors required for RNAP binding and transcription initiation. Sigma54 alternative sigma factor involved in transcribing nitrogen-regulated genes (among others). Encoded by rpoN (ntrA ). Discussed in more detail in Ronson et al paper. When bound to RNAP Core allows recognition of different promoters. Requires an additional activator to allow open complex formation for transcription. Sigma32 heat shock factor involved in activation of genes after heat shock. Encoded by rpoH (htpR ). Turned on by heat shock (either at the transcription or protein level). Activates multiple genes involved in the heat shock response. SigmaS (sigma38) stationary phase sigma factor. Encoded by rpoS . Turned on in stationary phase. Activates genes involved in long term survival, eg. peroxidase.

Sigma and Phage SP01 Early promoter—recognized by bacterial sigma factor. Transcription includes product, gp28. gp28 recognizes a phage promoter for expression of mid-stage genes, including gp33/34, which recognizes promoters for late gene expression. Early promoter—recognized by bacterial sigma factor. Transcription includes product, gp28. gp28 recognizes a phage promoter for expression of mid-stage genes, including gp33/34, which recognizes promoters for late gene expression.

Promoter Clearance and Elongation
Occurs after nt are added First rnt becomes unpaired from antisense (template) strand.DNA strands re-anneal Polymerase loses sigma, sigma recycled Result “Closed hand” surrounds DNA NusA binds to core polymerase As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal. RNA pol/NusA complex stays on until termination. Rate=20-50nt/second. Occurs after nt are added First rnt becomes unpaired from antisense (template) strand.DNA strands re-anneal Polymerase loses sigma, sigma recycled Result “Closed hand” surrounds DNA NusA binds to core polymerase As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal. RNA pol/NusA complex stays on until termination. Rat=20-50nt/second.

Termination Occurs at specific sites on template strand called Terminators Two types of termination Intrinsic terminators Rho () dependent treminators Sequences required for termination are in transcript Variation in efficiencies. Occurs at specific sites on template strand called Terminators Two types of termination Intrinsic terminators Rho () dependent treminators Both types have required sequences immediately prior to the terminator sequence Variation in erfficiencies

Intrinsic Terminators
DNA template contains inverted repeats (G-C rich) Can form hairpins 6 to 8 A sequence on the DNA template that codes for U Consequences of poly-U:poly-A stretch? Coding strand

Intrinsic Termination
RNA pol passes over inverted repeats Hairpins begin to form in the transcript Poly-U:poly-A stretch melts RNA pol and transcript fall off UUUUU Model for intrinsic termination (withdrawal) rU:dA base pair are exceptionally weak (Tm=200C Hair-pins: release RNA (ds structure) A string U’s: pause transcription

Rho () Dependent Terminators
rho factor is ATP dependent helicase catalyses unwinding of RNA: DNA hybrid rho termination factor: - rho factor is ATP dependent helicase - catalyses unwinding of RNA: DNA hybride - binds to C rich region of RNA transcript - moves along RNA chain to transcription site (bubble) - in the transcription site it catalyses separation of RNA and template DNA

Rho Dependent Termination
(17 bp) Rho Dependent Termination rho factor is ATP dependent helicase catalyzes unwinding of RNA: DNA hybrid 50~90 nucleotides/sec rho factor is ATP dependent helicase catalyses unwinding of RNA: DNA hybrid 50~90 nucleotides/sec Is Rho a termination factor? Rho affects chain elongation, but not initiation. Rho causes production of shorter transcripts. Rho release transcripts from the DNA template.

Rho: Mechanism Rho binds to transcript at  loading site (up stream of terminator) Hairpin forms, pol stalls Rho helicase releases transcript and causes termination Rho-factor hexameric protein Trails RNA polymerase 5’-3’ and hydrolyzes ATP when ssRNA is present Rho is activated by sequences in the nascent mRNA molecule that are rich in cytosine and poor in guanine. Attaches to the Transcript recognition sequence. Moves along transcript. Rho then displaces the RNA polymerase from the DNA template (RNA-DNA helicase) As the RNApol transcribes the inverted repeats, the transcript forms a stem-loop structure that is stabilized by G-C complementarity. Meanwhile the U-tail is complementary to the stretch of A (weak interaction). Structural stability of G-C hairpin and weak base pairing appear to be important factors in ensuring termination. No precise length beyond teermination signals. Hairpin causes RNA pol to stall. May induce conformational change in RNA pol (mimics sigma?), allowing DNA to reanneal, thus displacing transcript. Additionally, may be involvement of downstream sequences. hexamer

Abortive initiation, elongation
Synthesis begins at a promoter. Recognition by RNA pol holoenzyme (requires sigma). Abortive initiation, elongation

mRNA Function—Transcribe message from DNA to protein synthesis machinery Codons Bacterial—polycistronic Eukaryotic– monocistronic Leader sequence—non-translated at 5’ end May contain a regulatory region (attenuator) Also untranslated regions at 3’ end. Spacers (untranslated intercistronic sequences) Prokaryotic mRNA—short lived Eukaryotic mRNA-can be long lived Function—Transcribe message from DNA to protein synthesis machinery Codons Bacterial—polycistronic Eukaryotic– monocistronic Leader sequence—non-translated at 5’ end May contain a regulatory region (attenuator) Also untranslated regions at 3’ end. Spacers (untranslated intercistronic sequences) Prokaryotic mRNA—short lived Eukaryotic mRNA-can be long lived  If a bacterium needs a protein quickly, it can upregulate quickly, but once the need has passes, it doesn’t waste resources making an unnecessary protein

Stable RNA rRNA -Structural component of ribosomes
tRNA-Adaptors, carry aa to ribosome Synthesis Promoter and terminator Post-transcriptional modification (RNA processing) Evidence Both have 5’ monophospates Both much smaller than primary transcript tRNA has unusual bases. EX pseudouridine

tRNA and rRNA Processing
Both are excised from large primary transcripts 1º transcript may contain several tRNA molecules, tRNA and rRNA rRNAs simply excised from larger transcript tRNAs modified extensively 5. Base modifications Both are excised from large primary transcripts 1º transcript may contain several tRNA molecules, tRNA and rRNA rRNAs simply excised from larger transcript EX. Transcription of the rrnD operon yields a 30S precursor, which must be cut up to release the three rRNA and three tRNAs. tRNAs modified extensively EX. tRNATyr Endonuclease cleaves ~200 bases from 3’ end RNase D removes 7 bases from 3’ end RNAse P generates 5’ end, leaving a monophosphate RNase D generates 3’ CCA end Extensive modification of bases, all in or near the loops

Examples of Covalent Modification of Nucleotides in tRNA
N6-Methyladenylate (m6A) N6-Isopentenyladenylate (i6A) Inosinate (I) 7-Methylguanylate (m7G) tRNA modified bases Dihydrouridylate (D) Pseudouridylate (Ψ) (ribose at C-5) Uridylate 5-oxyacetic acid (cmo5U) 3-Methylcytidylate (m3C) Modifications are shown in blue. 5-Methylcytidylate (m5C) 2’-O-Methylated nucleotide (Nm)

Eukaryotic Transcription
Regulation very complex Three different pols Distinguished by -amanitin sensitivity Pol I—rRNA, least sensitive Pol II– mRNA, most sensitive Pol III– tRNA and 5R RNA moderately sensitive Each polymerase recognizes a distinct promoter Regulation very complex Three different pols distinguished by -amanitin sensitivity Pol I—rRNA least sensitive Pol II– mRNA most sensitive Pol III– tRNA moderately sensitive Each polymerase recognizes a distinct promoter Promoters recognized Pol I—bipartite promoter Pol II– Upstream promoter Pol III—internal promoter

Eukaryotic RNA Polymerases
Location Products -Amanitin Sensitivity Promoter I Nucleolus Large rRNAs (28S, 18S, 5.8S) Insensitive bipartite promoter II Nucleus Pre-mRNA, some snRNAs Highly sensitive Upstream III tRNA, small rRNA (5S), snRNA Intermediate sensitivity Internal promoter and terminator -amanitin used to distinguish different polymerases. Poison derived from mushrooms (Amanita sp.). How does this explain the reason mushrooms poison the way they do?

Eukaryotic Polymerase I Promoters
RNA Polymerase I Transcribes rRNA Sequence not well conserved Two elements Core element- surrounds the transcription start site (-45 to + 20) Upstream control element- between -156 and -107 upstream Spacing affects strength of transcription RNA Polymerase I Transcribes rRNA Sequence not well conserved Architecture well conserved Two elements Core element- surrounds the transcription start site Upstream control element- ~ 100 bp upstream

Eukaryotic Polymerase II Promoters
Much more complicated Two parts Core promoter Upstream element TATA box at ~-30 bases Initiator—on the transcription start site Downstream element-further downstream Many natural promoters lack recognizable versions of one or more of these sequences Much more complicated Two parts Core promoter Upstream element TATA box at ~-30 bases Initiator—on the transcription start site Downstream element-further downstream Many natural promoters lack recognizable versions of one or more of these sequences

TATA-less Promoters Some genes transcribed by RNA pol II lack the TATA box Two types: Housekeeping genes ( expressed constitutively). EX Nucleotide synthesis genes Developmentally regulated genes. EX Homeotic genes that control fruit fly development. Specialized (luxury) genes that encode cell-type specific proteins usually have a TATA-box

mRNA Processing in Eukaryotes
Primary transcript much larger than finished product Precursor and partially processed RNA called heterogeneous nuclear RNA (hnRNA) Processing occurs in nucleus Splicing Capping Polyadenylation Primary transcript much larger than finished product Precursor and partially processed RNA called heterogeneous nuclear RNA (hnRNA) Processing occurs in nucleus Splicing Capping Polyadenylation

Capping mRNA 5’ cap is a reversed guanosine residue so there is a 5’-5’ linkage between the cap and the first sugar in the mRNA. Guanosine cap is methylated. First and second nucleosides in mRNA may be methylated 1. 5’ cap is a reversed guanosine residue so there is a 5’-5’ linkage between the cap and the first sugar in the mRNA. 2. Guanosine cap is methylated. 3. First and second nucleosides in mRNA may be methylated What is the function of the 5’ cap? Clue: some viral mRNAs are not capped, yet they are translated efficiently and are stable. In these virus-infected cells the mechanism for initiation of mRNA translation is altered so that capped mRNAs are not translated efficiently! BACK

Polyadenylation Polyadenylation occurs on the 3’ end of virtually all eukaryotic mRNAs. Occurs after capping Catalyzed by polyadenylate polymerase Polyadenylation associated with mRNA half-life Histones not polyadenylated Polyadenylation occurs uniquely on mRNA, not tRNA or ribosomal RNA. This allows simple and rapid purification of mRNA by hybridization to an affinity resin composed of oligo-dT. Histone mRNA is the only non-polyadenylated mRNA in the cell. Why is this??? May be related to histone synthesis uniquely during S-phase of the cell cycle.

Introns and Exons Introns--Untranslated intervening sequences in mRNA
Exons– Translated sequences Process-RNA splicing Heterogeneous nuclear RNA (hnRNA)-Transcript before splicing is complete Introns--Untranslated intervening sequences in mRNA Exons– Translated sequences Process-RNA splicing

Splicing Overview Occurs in the nucleus
hnRNAs complexed with specific proteins, form a ribonucleoprotein particle (RNP) Primary transcripts assembled into hnRNP Splicing occurs on spliceosomes consist of Small nuclear ribonucleoproteins (SnRNPs) components of spliceosomes Contain small nuclear RNA (snRNA) Many types of snRNA with different functions in the splicing process Occurs in the nucleus hnRNAs complexed with specific proteins, form a ribonucleoprotein particle (RNP) Primary transcripts assembled into hnRNP During splicing, the snRNPs, RNA transcript and other factors come together to make a complex called a spliceosome. Spliceosomes consist of: Small nuclear ribonucleoproteins (SnRNPs) components of spliceosomes Contain small nuclear RNA (snRNA) Many types of snRNA with different functions in the splicing process snRNPs are composed of proteins and small nuclear RNA (snRNA).

Spliceosome

Splice Site Recognition
Introns contain invariant 5’-GU and 3’-AG sequences at their borders (GU-AG Rule) Recognized by small nuclear ribonucleoprotein particles (snRNPs) that catalyze the cutting and splicing reactions. Internal intron sequences are highly variable even between closely related homologous genes. Alternative splicing allows different proteins from a single original transcript Precision is essential in splicing Introns contain invariant 5’-GU and AG-3’sequences at their borders Internal intron sequences are highly variable even between closely related homologous genes. These consensus sequences are recognized by small nuclear ribonucleoprotein particles (snRNPs) that catalyze the cutting and splicing reactions.

Simplified Splicing Mechanism
2’ hydroxyl group of an A nt within the intron attacks the phosphodiester bond linking the first exon to the intron. This attack breaks the bond between exon 1 and the intron, yielding the ree exon and a lariat exon-intron intermediate, with the GU linked to the internal A via a phosphodiester linkage to C-2 of ribose. Free 3’ –OH on exon 1 attacks phosphodiester bond between intron and exon 2. Yields spliced exon1-exon2 and lariat shaped intron. Phosphate at end of exon 2 becomes the phosphate linking the 2 exons.

Close-up of Internal A NOTE attachment at C-2

Alternative Splicing I
Exon removed with intron

Alternative Splicing II
Multiple 3’ cleavage sites EX. AG found at 5’ end of exon 2 and inside exon 2

RNA pol III Precursors to tRNAs,5SrRNA, other small RNAs
Promoter Type I Lies completely within the transcribed region 5SrRNA promoter split into 3 parts tRNA promoters split into two parts Polymerase II-like promoters EX. snRNA Lack internal promoter Resembles pol II promoter in both sequence and position Precursors to tRNAs,5SrRNA, other small RNAs Promoter Type I Lies completely within the transcribed region 5SrRNA promoter split into 3 parts tRNA promoters split into two parts Polymerase II-like promoters EX. snRNA Lack internal promoter Resembles polII promoter in both sequence and position

DNAse Footprinting Use: promoter ID End Label template strand
Add DNA binding protein Digest with DNAse I Remove protein Separate on gel Use: Promoter ID, identification of sequences involved in recognition by proteins End Label template strand Add DNA binding protein Digest with DNAse I Remove protein Separate on gel Run next to sequencing gel (Maxam-Gilbert Sequencing) Will get all sizes represented unless they could not be made because the section was protected by a DNA binding protein. Can focus on region of binding. Protected region

siRNA and microRNA

Maxam-Gilbert Sequencing
Prep ssDNA End label Treat with different reagents specific for each nt

RNA Splicing RNA splicing is the removal of intervening sequences (IVS) that interrupt the coding region of a gene Excision of the IVS (intron) is accompanied by the precise ligation of the coding regions (exons)

Eukaryotic Transcription
3 classes RNA pol (I-III) Many mRNA long lived 5’ and 3’ ends of mRNA modified. EX. 5’ cap Poly-A tail Primary mRNA transcript large, introns removed mRNA-monocistronic 3 classes RNA pol (I-III) Many mRNA long lived 5’ and 3’ ends of mRNA modified. EX. 5’ cap Poly-A tail Primary mRNA transcript large, introns removed Monocistronic

Eukaryotic RNA Polymerases
Location Products -Amanitin sensitivity I Nucleolus Large rRNAs (28S, 18S, 5.8S) Insensitive II Nucleus Pre-mRNA, some snRNAs, snoRNAs Highly sensitive III tRNA, small rRNA (5S), snRNA Intermediate sensitivity

Methods for Studying Regulatory DNA
DNAse footprinting: (aka DNAse protection assay) identifies the sequence of DNA bound by a transcription factor protein binding prevents DNA from being attacked by DNAse I otherwise DNAse I cuts random sequences so that bands of many sizes are found on a gel everywhere EXCEPT where the transcription factor protects the DNA

DNA Footprinting

What are the roles of TAFs?
TAFIIs help TBP with transcirption from promoters with initiators an downstream elemens

The bacterium have several rrn operons that contain rRNA genes.
Prokaryotes rrn operons The bacterium have several rrn operons that contain rRNA genes. Transcription of the rrnD operon yields a 30S precursor, which must be cut up to release the three rRNA and three tRNAs. rRNA processing tRNA tRNA tRNA

Formation of a cap at the 5’ end of a eukaryotic mRNA precursor
1 2 4 3

DNA footprinting 1 2 short segment of 32P end-labeled dsDNA
Unprotected control DNA 2. Protected by DNA binding protein Partial digestion with DNase Gelelectrophoresis and autoradiography 32P end-labeled fragments

Facts to remember DNA-dependent RNA synthesis:
starts at a promoter sequence, ends at termination signal the first 5’-triphosphate is NOT cleaved proceeds in 5’ to 3’ direction new residues are added to the 3’ OH the template is copied in the 3’ – 5’ direction forms a temporary DNA:RNA hybrid transcription rate ( 50 to 90 nts/sec) RNA polymerase has complete processivity starts at a promoter sequence, ends at termination signal the first 5’-triphosphate is NOT cleaved proceeds in 5’ to 3’ direction new residues are added to the 3’ OH the template is copied in the 3’ – 5’ direction forms a temporary DNA:RNA hybrid transcription rate ( 50 to 90 nts/sec) RNA polymerase has complete processivity

Rho (protein) dependent termination
Is Rho a termination factor? Rho affects chain elongation, but not initiation. Rho causes production of shorter transcripts. Rho release transcripts from the DNA template.

DNA termination site: sites on DNA with specific structure DNA template contains inverted repeats 6 to 8 A sequence on the DNA template that codes for U

Transcription Chapter 8.

Similar presentations

Presentation on theme: "Transcription Chapter 8."— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Transcription Chapter 8.

Similar presentations

Presentation on theme: "Transcription Chapter 8."— Presentation transcript:

Similar presentations

About project

Feedback