Download presentation
Presentation is loading. Please wait.
1
UMass Lowell Computer Science 91.404 Analysis of Algorithms Prof. Karen Daniels Fall, 2005 Design Patterns for Optimization Problems Dynamic Programming
2
Algorithmic Paradigm Context Divide & Conquer Dynamic Programming View problem as collection of subproblems “Recursive” nature Independent subproblems Number of subproblems depends on partitioning factors typically small Preprocessing Characteristic running time typically log function of n depends on number and difficulty of subproblems Primarily for optimization problems Optimal substructure: optimal solution to problem contains within it optimal solutions to subproblems Overlapping subproblems
3
Dynamic Programming Approach to Optimization Problems 1. Characterize structure of an optimal solution. 2. Recursively define value of an optimal solution. 3. Compute value of an optimal solution in bottom-up fashion. 4. Construct an optimal solution from computed information. source: 91.503 textbook Cormen, et al.
4
Dynamic Programming Longest Common Subsequence
5
Example: Longest Common Subsequence (LCS): Motivation ä Strand of DNA: string over finite set {A,C,G,T} ä each element of set is a base: adenine, cytosine, guanine or thymine ä Compare DNA similarities ä S 1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA ä S 2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA ä One measure of similarity: ä find the longest string S 3 containing bases that also appear (not necessarily consecutively) in S 1 and S 2 ä S 3 = GTCGTCGGAAGCCGGCCGAA source: 91.503 textbook Cormen, et al.
6
Example: LCS Definitions ä Sequence is a subsequence of if (strictly increasing indices of X) such that ä example: is subsequence of with index sequence ä Z is common subsequence of X and Y if Z is subsequence of both X and Y ä example: ä common subsequence but not longest ä common subsequence. Longest? Longest Common Subsequence Problem: Given 2 sequences X, Y, find maximum-length common subsequence Z. source: 91.503 textbook Cormen, et al.
7
Example: LCS Step 1: Characterize an LCS THM 15.1: Optimal LCS Substructure Given sequences: For any LCSof X and Y: 1 if thenand Z k-1 is an LCS of X m-1 and Y n-1 2 if thenZ is an LCS of X m-1 and Y 3 if thenZ is an LCS of X and Y n-1 PROOF: based on producing contradictions 1 a) Suppose. Appending to Z contradicts longest nature of Z. b) To establish longest nature of Z k-1, suppose common subsequence W of X m-1 and Y n-1 has length > k-1. Appending to W yields common subsequence of X, Y of length > k = contradiction. b) To establish longest nature of Z k-1, suppose common subsequence W of X m-1 and Y n-1 has length > k-1. Appending to W yields common subsequence of X, Y of length > k = contradiction. 2 Common subsequence W of X m-1 and Y of length > k would also be common subsequence of X m, Y, contradicting longest nature of Z. 3 Similar to proof of (2) source: 91.503 textbook Cormen, et al.
8
Example: LCS Step 2: A Recursive Solution ä Implications of Thm 15.1: ? yes no Find LCS(X m-1, Y n-1 ) Find LCS(X m-1, Y) Find LCS(X, Y n-1 ) LCS(X, Y) = LCS(X m-1, Y n-1 ) + x m LCS(X, Y) = max(LCS(X m-1, Y), LCS(X, Y n-1 ))
9
Example: LCS Step 2: A Recursive Solution (continued) ä Overlapping subproblem structure: ä Recurrence for length of optimal solution: Conditions of problem can exclude some subproblems! c[i,j]= c[i-1,j-1]+1 if i,j > 0 and x i =y j max(c[i,j-1], c[i-1,j])if i,j > 0 and x i =y j 0 if i=0 or j=0 (mn) distinct subproblems source: 91.503 textbook Cormen, et al.
10
Example: LCS Step 3: Compute Length of an LCS source: 91.503 textbook Cormen, et al. c table c table (represent b table) (represent b table) B CB A B C B A 0 1 2 3 4 What is the asymptotic worst- case time complexity?
11
Example: LCS Step 4: Construct an LCS source: 91.503 textbook Cormen, et al.
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.