Construction of Reporter Luciferase Genes to Assess NOC4 expression Finding the Promoter Region of the NOC4 Gene. Nicholas Simon Faculty Sponsor: Nancy.

Similar presentations


Presentation on theme: "Construction of Reporter Luciferase Genes to Assess NOC4 expression Finding the Promoter Region of the NOC4 Gene. Nicholas Simon Faculty Sponsor: Nancy."— Presentation transcript:

1 Construction of Reporter Luciferase Genes to Assess NOC4 expression Finding the Promoter Region of the NOC4 Gene. Nicholas Simon Faculty Sponsor: Nancy Bachman

2 Overview  Luciferase Vectors  Mutagenesis Strategy  Bioinformatics  Mutagenesis  Transformation  DNA Sequencing  Reporter Assays

3 Luciferase Vectors  Vectors have four features  they are able to replicate  they have selectable markers  foreign DNA can be inserted in them  they often carry a reporter gene

4 Luciferase Vectors

5 Mutagenesis Strategy  Point Mutations or Deletions? Point mutation in a region of 250bp – need 30 primers Deletion in a region of 250bp – need only 6 primers Issues: Cost and Saturation Deletion was Best

6 Deletions  cttctctatcgataggtaccgagctcttacgcgtaggtaccgagctcttacgcgtg cggccgcgggctggcgggggacccttcaggcccggccccgtttgggcctcggct cctggaaaagcgactcgcgcctctgggaagccgcagccccagactccagtcgc gcttctcgcccggcgccgccggaaagcagcctctccaacgcctgccggaaagc agcccggcccggcattttacgacgttcgcagcgctacccttttccgctccacggtg acctccgtgcggccgggtgcgggcggagtcttcctcgatcccgtggtgctccgcg gcgcggccttgctctcttccgggggctcgagatctgcgatctaagtaagcttggc att  tttctctatcgataggtaccgagctcttacgcgtaggtaccgagctcttacgcgtg cggccgcgggctggcgggggacccttcaggcccggccccgtttgggcctcggct cctggaaaagcgactcgcgcctctgggaagccgcagccccagactccagtcgc gcttctcgcccggcgccgccggaaagcagcctctccaacgcctgccggaaagc agcccggcccggcattttacgacgttcgcagcgctacccttttccgctccacggtg acctccgtgcggccgggtgcgggcggagtcttcctcgatcccgtggtgctccgcg gcgcggccttgctctcttccgggggctcgagatctgcgatctaagtaagcttggc att

7 General Strategy

8 Bioinformatics  Used to design primers Minimize secondary structures

9  Denature the DNA template  Anneal the primers  Synthesize the mutant strand

10

11 DNA Sequencing  Purify the Vector DNA from E. coli  Cycle DNA sequencing

12 Reporter Assays  Transfect the DNA vector into HeLa cells  Wait for 24 hours so cell will express the luciferase  Then measure luciferase activity

13 And What Happens If No Expression?


Download ppt "Construction of Reporter Luciferase Genes to Assess NOC4 expression Finding the Promoter Region of the NOC4 Gene. Nicholas Simon Faculty Sponsor: Nancy."

Similar presentations


Ads by Google