1. Intra-population genetic diversity of beech in northeast Serbia assessed by microsatellite markers Marina NONIĆ 1, Berthold HEINZE 2, Michael MENGL 2, Jovana DEVETAKOVIĆ 1, Renate SLUNSKY 2 1 University of Belgrade – Faculty of Forestry, Belgrade, Serbia 2 Federal Research and Training Centre for Forests, Natural Hazards and Landscape (BFW) Department of Forest Genetics (Unit of Genome Research), Vienna, Austria International Conference REFORESTATION CHALLENGES Belgrade, Serbia 03-06 June 2015

2. Contents Results and discussion 3 Introduction 1 Material and methods 2 Conclusions 4 International Conference REFORESTATION CHALLENGES

3. Introduction INTRODUCTION INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 1 International Conference REFORESTATION CHALLENGES Genus Fagus L. consists of ten beech species In Serbia it includes 3 species: European beech - Fagus sylvatica L., Oriental beech - Fagus orientalis Lipsky, Balkan beech - Fagus moesiaca (Domin, Maly) Czeczott. The taxonomical status of beech from the Balkan Peninsula: an independent species (Czeczott 1933; Mišić 1957; Jovanović M. 1971; Jovanović B. 1985; Jovanović and Cvjetićanin 2005); subspecies of Fagus sylvatica L. (Janković 1970; Gӧmӧry et al. 1999); synonym of Fagus sylvatica L. (Denk et al. 2002).

4. Introduction INTRODUCTION INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 1 International Conference REFORESTATION CHALLENGES Balkan beech in Serbia grows in various structural forms (pure and mixed forest communities, both with broadleaves, and with conifers), depending on its adaptation to environmental conditions; Wide range of vertical (from 40 m to 2100 m) and horizontal distribution; A dominant forest species in the growing stock of Serbia - 50.4% per volume.

5. Introduction INTRODUCTION INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 1 International Conference REFORESTATION CHALLENGES Capacity of forest trees to survive threats (climate change, habitat fragmentation, environmental pollution), is dependent on their adaptive potential, mainly determined by genetic diversity. Genetic structure of beech populations and diversity of beech species were subjects of numerous research; The aim of this research was to determine intra-population genetic diversity of one beech (Fagus moesiaca /Domin, Maly/ Czeczott) population in northeastern Serbia, at the molecular-genetic level; Usefulness of microsatellite markers (SSRs) in the field of population genetics of various forest tree species.

6. Material and Methods 2 International Conference REFORESTATION CHALLENGES METHODS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS Latitude (N) Longitude (E) Altitude (m) 44° 27' 42''21° 59' 5''670 Population “Boljetinska reka” In NP Djerdap – more than 55%

7. Material and Methods International Conference REFORESTATION CHALLENGES The samples of 45 juvenile beech plants (aged between 3 and 5 years) from the population were selected; Undamaged dormant buds were harvested from each individual and were dried and preserved in plastic zip lock bags with silica gel until DNA isolation; The laboratory work was done at the Federal Research and Training Centre for Forests, Natural Hazards and Landscape - Department of Genetics, Unit of Genome Research in Vienna, Austria. METHODS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 2

8. Material and Methods International Conference REFORESTATION CHALLENGES METHODS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 2

9. Material and Methods DNA was extracted from dried plant material (approximately 60 mg of starting material) using the Invisorb Spin Plant Mini Kit (STRATEC Molecular GmbH, Germany), following manufacturer's instructions.; Plant material was disrupted using the TissueLyser (Qiagen) - rapid and efficient disruption of 2 x 24 samples in parallel; DNA concentration and purity - determined spectrophotometrically and by DNA electrophoresis on an agarose gel. METHODS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 2

10. Material and Methods DNA at the microsatellite loci was amplified by the polymerase chain reaction (PCR). PCR was performed using the Programmable Thermal Controller PTC-100 (MJ Research), and the amplification products were resolved on 1.5% agarose gel. Fragment length sizing and allele determination of the obtained PCR products were performed using the capillary electrophoresis automatic sequencer CEQ™ 8000 Genetic Analyzer System (Beckman Coulter). METHODS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 2

11. Five primer pairs of microsatellite loci were used to asess intra-population genetic diversity (Tab. 1) Material and Methods Table 1. Primer sequences and characteristics of five used polymorphic microsatellite markers METHODS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 2 No.SSR locusForward/Reverse primer sequences (5'-3') Repeat sequence Allele size range (bp) 1csolfagus_19 F: TGCCCATGAGGTTTGTATCA (TC) 13 154-182 R: GCCGAATAACCCAGAAAACA 2csolfagus_31 F: TCTATTGACACAAGAATAAGAACACC (AG) 12 104-126 R: CTTGGCAAGAAAAGGGGATT 3sfc_0036 F: CATGCTTGACTGACTGTAAGTTC (TC) 23 94-112 R: TCCAGGCCTAAAAACATTTATAG 4DE576_A_0 F: TCTCCTTAGATCCACAATCACA (CAA) 10 211-232 R: AGCTCTTCATTGCTCAGAACG 5mfc5 F: ACTGGGACAAAAAAACAAAA (AG) 10 277-329 R: GAAGGACCAAGGCACATAAA

12. International Conference REFORESTATION CHALLENGES The following was determined for each microsatellite locus: Number of total alleles per locus (Na), Number of effective alleles (Ne), Observed heterozygosity (Ho), Expected heterozygosity (He), Fixation index (Fis). The same GenAlex Software was used to calculate: Genetic distances between selected trees within population, Significance test of deviation from Hardy-Weinberg equilibrium (HW), Allele frequency. Data analysis of the resulting electropherograms was carried out using the CEQ 8000 Analysis Software (Beckman Coulter) and GenAlEx 6.5 (Genetic Analysis in Excel) Software was used for further analyses. Material and Methods METHODS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS 2

13. Results and Discussion 3 International Conference REFORESTATION CHALLENGES RESULTS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS LocusNNaNeHoHeF csolfagus3145105.9380.8220.8320.011 csolfagus1945187.3770.8000.8640.075 sfc00364584.3410.6670.7700.134 DE576_A_04584.7870.6670.7910.157 mfc5452614.0630.7330.9290.211 Mean45147.3010.7380.8370.117 SE0,0003.5211.7700.0330.0280.034 Table 2. Levels of genetic diversity of analyzed beech population in Serbia Legend: N - number of individuals; Na - mean number of total alleles; Ne - mean number of effective alleles; Ho - observed heterozigosity; He - expected heterozigosity; Fis - fixation index/inbreeding coefficient

14. Table 3. The genetic distance between the selected beech trees in population

15. Results and Discussion 3 RESULTS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS LocusDFChiSqPSignif csolfagus314539,7750,692ns csolfagus19153199,1860,007** sfc00362851,9430,004** DE576_A_02832,1640,268ns mfc5325323,8850,507ns Legend: ns=not significant, * P<0.05, ** P<0.01, *** P<0.001 Table 4. Summary of Chi-Square Tests for Hardy-Weinberg Equilibrium The results of significant deviations from Hardy-Weinberg equilibrium per each locus are presented in Table 4. The probability of Chi-Square values for loci csolfagus19 and sfc0036 was less than 0.01 (0<P<0.01) - the results for these loci were statistically significant. There is no random mating within the studied population, but it should be checked on a higher number of trees.

16. In total 70 alleles pairs, in average 14 alleles per locus. Length of base pairs (bp) were in the range from 98 to 331 bp, depending on the used locus. Figure 1. Allele Frequencies by Population over all Loci

17. Results and Discussion 3 RESULTS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS

18. Results and Discussion 3 RESULTS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS

19. Results and Discussion 3 RESULTS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS

20. CONCLUSIONS INTRODUCTION – METHODS – RESULTS – CONCLUSIONS Conclusions 4 The results concerning: the level of genetic diversity, inbreeding coefficient and genetic differentiation,  comparable and mainly within the range of earlier studies. Genetic analysis  the studied population is characterized by a high level of genetic diversity. Observed heterozygosity (overall Ho = 0.738) has been lower than the expected (overall He = 0.837), which indicates positive mean of fixation index values (overall Fis > 0 (0.117)) and implies a heterozygote deficiencies in the studied population, which could have an inbreeding system of mating. Beech is a dominant forest species in Serbia, and by this research, only partial genetic structure was provided, therefore, further study is certainly needed in other populations of this species in Serbia.

21. Acknowledgements Acknowledgements Financial support by the Transnational Access to Research Infrastructures activity in the 7th Framework Programme of the EC under the Trees4Future project for conducting the research is gratefully acknowledged. The first author thanks the Federal Research and Training Centre for Forests, Natural Hazards and Landscape (BFW), Vienna, Austria for hosting. International Conference REFORESTATION CHALLENGES Belgrade, Serbia 03-06 June 2015

22. Thank you for your attention marina.nonic@sfb.bg.ac.rs