1. What are microRNAs? Morten Lindow

2. Fire et al, Nature 1998 Worm embryo under phase contrast In situ staining for mex3 mRNA Mex3 inhibited with anti-sense RNA Mex3 inhibited with double stranded RNA

4. Without small RNAs  Transposons jump  Stem cells are lost  Brain and muscle fails to develop  Plants succumb to viral infection  Flowers take shapes unlikely to please a bee  Cells fail to divide for lack of centromeres  Insulin secretion is dysregulated

5. miRNA logic ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT miRNA gene Pri-miRNA A microRNA Inhibit mRNA translation Drosha Dicer Export Pre-miRNA

6. Additions to the Central Dogma Genome Transcriptome Proteome Regulation by proteins siRNA/miRNA Regulation by RNA Imprinting – methylation Splicing Ribozymes

7. microRNAs quantified

8. miRNA genes: genomic context +------------+----------+ | pos_type | count(*) | +------------+----------+ | antisense | 13 | | exonic | 5 | | intergenic | 109 | | intronic | 64 | +------------+----------+

9. Some miRNAs occur in clusters

10. miRNA targets  Very few experimentally validated targets < 50 and mostly in fly and worm < 50 and mostly in fly and worm  We have to rely on bioinformatic target predictions. Probably very noisy. 10% of all genes regulated by miRNAs ( Enright et al, 2003) 10% of all genes regulated by miRNAs ( Enright et al, 2003) 30% of all genes regulated by miRNAs (Lewis et al. 2004) 30% of all genes regulated by miRNAs (Lewis et al. 2004) ~all genes regulated to some degree (others) ~all genes regulated to some degree (others)

11.  Screen a lot of different cells/tissues Cancer vs. Normal. Differentiated vs non-differentiated Cancer vs. Normal. Differentiated vs non-differentiated  Draw conclusions Cells of similar lineage have similar profiles Cells of similar lineage have similar profiles miRNAs are generally lower expressed in malignant (~undiffentiated) cells miRNAs are generally lower expressed in malignant (~undiffentiated) cells miRNA profiles can classify tumors (supposedly better than mRNAs) miRNA profiles can classify tumors (supposedly better than mRNAs)  Interesting dataset!! Parallel expression information of both mRNA and miRNA in 90 samples

12. Herpes virus microRNAs  Kaposi Sarcoma Virus (10)  Cytomegalo Virus (9)  Epstein-Barr Virus (5) Mononucleosis Mononucleosis UUAAUGCUUAGCCUGUGUCCGA- (Ks.K9) UUAAUGCUAAUCGUG-AUAGGGG (Hs.155) CCAGCAGCACCUAAUCCAUCGG-- (Ks. K3-5p) -UAGCAGCACGUAAAU-AUUGGCG (Hs. 16) 5’3’

13. microRNAs and hematopoesis Genome Biol. 2005;6(8):R71. Epub 2005 Aug 1

14. microRNAs and stem cells  Drosophila germline stem cells  dcr-1 mutant has fewer clonal cysts than wt.  Effect via Dap. Hatfield et. al., Nature 2005

15. microRNAs and cardiogenesis  Excess miR-1-1  decreased cardiomyocytes  Effect is via miR-1-1 targeting of Hand2 transcription factor Zhao et al. Nature 2005

16. microRNAs and brain Dicer mutants – do not process miRNA Rescued by injected mature miRNAs Giraldez et al, Science 2005