1. Doug Davis Plant Science Division Univ. of Missouri 6/26/06
How to Install and Use a Standalone BLAST (Basic Local Alignment Search Tool) Server
Doug Davis
Plant Science Division
Univ. of Missouri
6/26/06

2. Lab Premise Bioinformatics research is typically web-based
Access to necessary URLs may be hampered by need for administrator permissions
Solution: Standalone BLAST (you will be provided a CD containing all necessary files at the lab’s conclusion)

3. Lab Goals
See where BLAST fits into the larger scheme of bioinformatics
Demonstrate installation of a standalone BLAST server on a Windows XP PC (should also work on a Windows 2000 PC)
Gain initial familiarity with available standalone BLAST parameters

4. Bioinformatics Defined
Study of biological questions using computers in place of traditional labware (e.g. test tubes, pH meters, electrophoretic equipment)
Dependent on databases containing molecular data generated over many decades
Millions of sequences are in these databases; best of all, tools like BLAST can search for sequences in such large databases very rapidly

5. What Is BLAST?
BLAST is a program that searches for similarities among molecular sequences- works with nucleic acids and proteins
It performs local (as opposed to global) alignments using a special set of scoring matrices
It calculates statistical significance for any matches it finds (allows you to evaluate the degree of similarity)
a very powerful tool for characterizing unknown sequences by using sequence alignments to known sequences

6. The usual way BLAST is employed…
Requires an active internet connection to visit websites where molecular databases reside (e.g. you have a lot of flexibility working over the web (many different databases and informatics tools can be rapidly accessed)
You specify a target database to be searched using the website’s BLAST server
You upload the query sequences (these are the sequences you want to learn more about) to a web-BLAST server; then these sequences are compared by the BLAST alignment algorithm to all sequences in the specified target database

7. BLAST Session Setup
Target database sequences
This database contains many
sequences which are al-
ready characterized, these are
the “knowns”
Query sequence(s)
These are sequences you want
to know more about. Consider
them as “unknowns”.
BLAST
program
If BLAST detects a match between query sequences and
database sequences, this indicates some meaningful
relationship between the aligned sequences.

8. Here’s how the BLAST session looks in
“Command Prompt” (this is the program
you will use in Windows to run BLAST):

9. Here’s the “Hit Table” Output from a BLAST
Session- the Hit Table format is a stripped-down
BLAST output

10. Hit Table Format of BLAST Output
The output report fields are outlined here
# BLASTN [May ]
# Query: 5221 sequences
# Database: maize_genes.txt
# Fields: Query, Subject, %ID, AlignLngth, Mismatch, Gaps, Qry_start, Qry_end, Subj_start, Subj_end, e-val, bit_score
CK TC
CF TC e
CF TC
CK TC e
CF TC e

11. BLAST Report Field Explanations
mismatches- number of nucleotides that don’t match over the length of the aligned portion
gaps- a confusing field, as these can be caused both by truncation of sequence or when there are multiple, contiguous mismatches in the middle of an alignment- then the matching algorithm introduces a gap into the alignment
e-value- a statistic which indicates the probability of recovering the sequence of interest, given the size of the database searched; it is strongly influenced by the size of the database searched
bit score- a probability statistic which takes the size of the searched database into account (high scores indicate strong alignments); unaffected by the size of the database searched

12. Default BLAST Output: Graphical Alignment
of Query Sequence to Subject Sequence in
the Target Database (nucleotide-nucleotide)
Query= gi| |gb|CK |CK zmrsub1_0B a11.s4
zmrsub1 Zea mays cDNA 3', mRNA sequence
(609 letters)
Score E
Sequences producing significant alignments: (bits) Value
TC UP|Q9LLI2_MAIZE (Q9LLI2) Cellulose synthase-8, complete
>TC UP|Q9LLI2_MAIZE (Q9LLI2) Cellulose synthase-8, complete
Length = 3931
Score = 32.2 bits (16), Expect = 0.34
Identities = 22/24 (91%)
Strand = Plus / Plus
Query: 531 cgaggcggaggacgccgtcgacga 554
||||| |||||||| |||||||||
Sbjct: 519 cgaggaggaggacggcgtcgacga 542

13. How Does BLAST Make the Alignments?C O E L A N T H P 1 2 I 3 4
Answer: Local Alignment is based on the “Smith-Waterman Algorithm”
the local alignment produced by this algorithm is: ELACAN
ELICAN

14. How to Calculate Smith-Waterman Matrix Values
Matches are assigned a value of +1, mismatches are -1, gaps (where there is no character to try matching with in one of the sequences) are also assigned a value of -1
Calculate the match score: sum of the score in the preceeding diagonal cell plus the gap penalty (+1 if no gap, -1 if there is a gap)
Calculate the horizontal gap score: sum of the cell to the left plus the gap penalty
Calculate the vertical gap score: sum of the cell above plus the gap penalty
The maximum score is never less than 0.

15. What Types of Questions Can BLAST Be Used to Answer?
Find genes in a genomic sequence
Predict a protein’s function
Predict the 3-D structure of a protein
Identify members of gene/protein families

16. Why install a Standalone Copy of BLAST?
You don’t need administrator permissions to run it
Easier to control the output format (you aren’t stuck with what the website decides you should have)
More user control (easier to construct custom BLAST queries)

17. Flow of Events in a BLAST Session
create a file
that contains the
query sequences
create a blank file
that will receive the
BLAST output
format the target
database (protein or
nucleic acid)
submit the BLAST
job using the
command prompt
review the BLAST
output; formulate
new hypothesis

18. BLAST Installation Details: Part 1
Insert the provided CD and locate the file named “ncbi.ini” (this file contains the path to the BLAST\data subfolder)
Click the “Start” button on your desktop, then click on “My Computer”, then click on the C:\ drive
Open the WINDOWS, WINNT, or WINDOWS NT folder and drag the ncbi.ini file into either of these folders

19. BLAST Installation Details:Part 2
Go to C:\Program Files
Drag the BLAST folder on your CD into the C:\Program Files folder- be careful to not place it inside another folder that resides in C:\Program Files.
Open the BLAST folder and click the file named “blast ia32-win32” to install the BLAST application

20. BLAST Installation Details: Part 3
Drag the .txt file “maize_genes” from the CD into the “C:\Program Files\BLAST\data” folder
Create and save a blank text (.txt) file named “query_seqs” in the “C:\Program Files\BLAST\data” folder
Open the .txt file named “Install_Lab_seqs” from the CD, and copy the contents; paste these into the file “query_seqs” then save the file
Create and save a .txt file named “output” in the “C:\Program Files\BLAST\data” folder- this file will receive the BLAST output

21. BLAST Installation Details: Part 4
Move the following files from the “C:\Program Files\BLAST\bin” folder into the “C:\Program Files\BLAST\data” folder: “formatdb”, “blastall”, “blastclust”, and “megablast” (these are the “executable” files you will need to make BLAST run)
Click Start, select “All Programs”, then select “Accessories”; click the “Command Prompt” icon to open a “command line” session

22. Get Ready to BLAST
Type the following in at the command prompt: “formatdb –i maize_genes.txt –p F –o F” (this command will format the target database, maize_genes.txt, so that it can be searched by BLAST)

23. Using Standalone BLAST
At the command prompt, type the following: C:\Program Files\BLAST\data>megablast -i query_seqs.txt -d maize_genes.txt -o output.txt -F "m D" -D 3
Press the Enter button, then BLAST will start processing the commands
When the program terminates (you will get a new command prompt), open the output.txt file to inspect the results.

24. Different Types of BLAST
There are 5 types of BLAST available:
megaBLAST: very rapid (~12-fold faster than BLASTN), DNA query against DNA databases
BLASTN: same set-up as megaBLAST, slower, but more options for query construction
BLASTP: protein used to search protein database
BLASTX: translated DNA search of protein database
TBLASTN: protein used to search translated DNA database
TBLASTX: DNA translated in all 6 frames versus a translated DNA database
We’ll look more at these this afternoon