1. Investigation of the Roles of Viral Proteinases in the Vaccinia Virus Life Cycle Jessica Page Mentor: Dr. Dennis Hruby Department of Microbiology

2. Vaccinia Virus: A close relative to variola virus, the causative agent of smallpox. Vaccinia Background

3. The Disease Smallpox (variola major) Highly infectious 30-40% mortality Effective vaccine (VV) Global eradication in 1977 Remaining variola stocks to be destroyed in 2002 Biological threat gone ……or is it?

4. Significance Smallpox has become a possible weapon of bioterrorism Smallpox has become a possible weapon of bioterrorism U.S. population has become immunologically naïve U.S. population has become immunologically naïve Vaccine not totally effective in attack situation Vaccine not totally effective in attack situation

5. Selection of appropriate antiviral target Proteinase inhibitor paradigm (HIV, HCV, etc.) Poxvirus proteinases Scientific Approach I7L G1L

6. Morphogenic Proteolysis VV Replication Cycle

7. 3036090420150480210240540300600660720780840 P4b (72 kDa) Amino Acids AGS AGA 252 P25K (28 kDa) 1832 P4a (97 kDa) 617 AGS 697 AGT AGA 60 VV Core Protein Cleavage Sites 645 892 25K (25 kDa) 4b (62 kDa) 4a (64 kDa)23K Virion core formation

8. I7LG1LTetO TRex293 Cell TetRepressor I7LG1LTetO TRex293 Cell TetRepressor Tetracycline Operator/Repressor I7LG1L Viral DNA vvTetO:G1L/I7L TetO No expression of G1L & I7L Tetracycline Expression of G1L & I7L TetR Tet “OFF” “ON”

9. ABC DEF Viral Phenotype +/- Tetracycline + tet - tet

10. My Goals Characterize the vvTetO:G1L/I7L modified virus Characterize the vvTetO:G1L/I7L modified virus Growth curve +/- tet vs. WR to demonstrate conditional lethality and fitness Growth curve +/- tet vs. WR to demonstrate conditional lethality and fitness Western blots of I7L and late core proteins p4a, p4b, p25K +/- tet vs. WR and transfected with G1L/I7L plasmids Western blots of I7L and late core proteins p4a, p4b, p25K +/- tet vs. WR and transfected with G1L/I7L plasmids Rescue with I7L and G1L alone and in tandem to demonstrate activity of each proteinase independently Rescue with I7L and G1L alone and in tandem to demonstrate activity of each proteinase independently Analysis of core protein processing Analysis of core protein processing

11. Genomic Sequencing Tetracycline Operator = TCCCTATCAGTGATAGAGA I7LTGATAATCCCTATCAGTGATAGAGAATGGAAAGATA G1LAAATGATCCCTATCAGTGATAGAGAATGATTGTCTT TetO Methionine Promoter (upstream)

12. MOI Optimization + tet - tet

13. Growth Curve

14. Immunoblot Detection of p4b Protein Cleavage p4b precursor 72 kDa 4b cleavage product 62 kDa + tet-tetWR

15. 3036090420150480210240540300600660720780840 P4b (72 kDa) Amino Acids AGS AGA 252 P25K (28 kDa) 1832 P4a (97 kDa) 617 AGS 697 AGT AGA 60 VV Core Protein Cleavage Sites 645 892 25K (25 kDa) 4b (62 kDa) 4a (64 kDa)23K Virion core formation

16. Immunoblot Detection of p4b Protein Cleavage p4b precursor 72 kDa 4b cleavage product 62 kDa + tet-tetWR

17. I7LG1LTetO TRex293 Cell TetRepressor Rescue Experiments TetR G1L plasmid I7L plasmid Expression of G1L and/or I7L Virion core formation and continuation of virus life cycle

18. Future Progress Continue to optimize experimental conditions to achieve successful rescue and analysis of late core proteins Continue to optimize experimental conditions to achieve successful rescue and analysis of late core proteins Try rescue with mutant I7L and G1L plasmids to determine the functional areas of the proteins Try rescue with mutant I7L and G1L plasmids to determine the functional areas of the proteins

19. THANKS!! Dr. Dennis Hruby Dr. Dennis Hruby Megan, Jen, Cliff, Chelsea, Kady, Su-Jung, Dina, Eric, and all the family Megan, Jen, Cliff, Chelsea, Kady, Su-Jung, Dina, Eric, and all the family Howard Hughes Medical Institute Howard Hughes Medical Institute