1. Expt. 10-1: P-elements and Enhancer Trapping

2. Expt. 10: P-elements and Enhancer Trapping -Naturally occurring P-elements: Transposase gene between two inverted repeats Transposase

3. Organization of the P Element 2.9 kb P Element Transposase ORF 31 bp Inverted Repeat Tnp Binding Site 9 or 21 bp Spacer

4. NNNNNNNNNCATGATGAAATAACATAAGGTGG NNNNNNNNNGTACTACTTTATTGTATTCCACC 3’ Cleavage Site 5’ Cleavage Site NNNNNNNNNCATGATGAAATAACATA NNNNNNNNN AGGTGG GTACTACTTTATTGTATTCCACC 3’-OH P -5’ 5’-P HO-3’ Transposase catalyzes a 17bp staggered cleavage event

5. P Element +

6. 8 bp target site duplication P element integration generates an 8 bp target site duplication

7. Taking Advantage of P-elements -Mutagenesis

8. Taking Advantage of P-elements -Mutagenesis -Insertional mutations easy to clone.

9. Taking Advantage of P-elements -Mutagenesis Insertional mutations (easy to clone). -Imprecise excisions lead to frameshifts -and deletions.

10. Taking Advantage of P-elements -Germline transformation

11. Taking Advantage of P-elements -Mutagenesis -Germline transformation 1.Design transgene with inverted repeats.

12. Taking Advantage of P-elements -Mutagenesis -Germline transformation 1.Design transgene with inverted repeats. 2.Mix with transposase gene

13. Taking Advantage of P-elements -Mutagenesis -Germline transformation 1.Design transgene with inverted repeats. 2.Mix with transposase gene 3.Inject into germline of embryo

14. Taking Advantage of P-elements Germline transformation 1.Design transgene with inverted repeats. 2.Mix with source of transposase 3.Inject into germline of embryo 4.Look for transformants in F 1. YFG

15. Taking Advantage of P-elements -Mutagenesis -Germline transformation -Enhancer trapping Use regulatory information from nearby genes to drive expression of a transgene

16. Mechanics of Enhancer Trapping: -Modified P-element contains: -Inverted repeats -Basic promoter sequences -Molecular marker gene (e.g.  -galactosidase) -Phenotypic marker (e.g. w +, ry + ) -Mobilize using transposase -Confirm hopping in F 1 (phenotype) -Look for interesting/desired expression pattern in F 2 with lacZ staining

17. Mechanics of Enhancer Trapping: -Modified P-element contains: -Inverted repeats -Basic promoter sequences -Molecular marker gene (e.g.  -galactosidase) -Phenotypic marker (e.g. w +, ry + ) -Mobilize using transposase -Confirm hopping in F 1 (phenotype) -Look for interesting/desired expression pattern in F 2 with lacZ staining

18. Attached X females XY X XXY ^

19. Attached X females XY X XXY XXX Sterile XXYFemale XYMale YYDead ^ ^ ^

20. + P[lacZ, ry + ], Cy ry + + Ki  ry + + Sco ry Y + + X

21. + P[lacZ, ry + ], Cy ry + + Ki  ry + + Sco ry Y + + X + P[lacZ, ry + ], Cy Ki  ry + XX + ry Y + ry (phenotype=Cy, Ki, ry + )

22. + P[lacZ, ry + ], Cy ry + + Ki  ry + + Sco ry Y + + X + P[lacZ, ry + ], Cy Ki  ry + XX + ry Y + ry (phenotype Cy, Ki, ry + ) X ^ ^

23. + P[lacZ, ry + ], Cy ry + + Ki  ry + + Sco ry Y + + X + P[lacZ, ry + ], Cy Ki  ry + XX + ry Y + ry (Cy, Ki, ry + ) X + P? + P? ry P? XX + ry Y + ry Y + ry (not Cy, not Ki. If carrying a jumped P, will be ry + ) ^ ^

24. + P[lacZ, ry + ], Cy ry + + Ki  ry + + Sco ry Y + + X + P[lacZ, ry + ], Cy Ki  ry + XX + ry Y + ry (Cy, Ki, ry + ) X + P? + P? ry P? XX + ry Y + ry Y + ry (not Cy, not Ki. If carrying a jumped P, will be ry + ) X Stain F 2 for lacZ Look for desired expression pattern ^ ^

25. We want to look at enhancer traps that express in the ovaries.

26. The Ovariole Germarium

27. The Ovariole

28. The Egg Chamber Nurse Cells Oocyte, follicle cells

29. Staining Ovaries Schematic Summary -Dissect ovaries out of abdomen in NaPO 4 buffer (movie!). -Devitallinize with heptane -Fix ovaries and wash -Add X-GAL, the substrate for  -galactosidase. -Wash when dark enough, and observe. -We are using enhancer traps that express in -Follicle cells -Nurse cells and oocyte