2. Gil Ast Dep. of Human Molecular Genetics and Biochemistry Room 1009, 10 th floor Tel: 6893 640

3. Sylabus The Cell by B. Alberts http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Books Essential Cell Biology by Alberts

4. Genetics Science of genes Molecular Biology Gene expression

6. Embryonic stem cells Day 1 Day 2-3Day 4Day 5 Day 6-9 Day 14

7. nucleus Gene - encodes for protein Each cell in our body contains the same genetic information (DNA)

8. The pathway of gene expression

12. H deoxy A nucleotide

13. RNADNA The sugar of RNA and DNA

14. O The base bind position 1

15. The bases

18. single strand DNA ssDNA

19. 1)5’-to-3’ Phosphodiester bond 2) direction 3) 5’ end 3’end 4) upstream and downstream

20. How to describe DNA GAACCTGAGACCTACTGGTCCG

22. Base-paring

23. Base pair = bp Double strand DNA = dsDNA dsDNA Anti-paralel

24. dsDNA 1.Anti-parallel 2.Complementary strand 3. ladder 4. Each basepair is called 1bp

25. A:T and G:C  = 10 -10

27. Gene – a DNA region that is transcribed to RNA, and the RNA with a biological function Gene 3

28. Intron – a region in the DNA that is transcribed but removed from the mRNA precursor and is not part of the mature mRNA Exons – part of the mature mRNA Introns are found only in eukaryotes

31. 2.91 billion base pairs 24,000 protein coding genes (~32,000 non-coding genes) 1.5% exons (127 nucleotides) 24% introns (~3,000 nucleotides) 75% intergenic (no genes) Average size of a gene is 27,894 bases Contains an average of 8.8 exons Titin contains 234 exons. Human genome

32. We humans are 99.9% identical at the DNA sequence level There are still ~3 million nucleotide differences among us called SNPs (60,000 within the exons)---that presumably account for differences in disease susceptibility, drug responses, etc. Polymorphic variation between and within populations Implications for concepts of “race,” “individuality”

33. 24,000

36. MOLECULAR BIOLOGY OF THE DISEASE Duchenne Muscular Dystrophy is one of more than twenty different types of muscular dystrophy. The Duchenne type affects only boys and is known to result from a defect in a single important protein in muscle fibers called Dystrophin. The muscle fiber will break down if the Dystrophin is missing and is unable to function properly. As a result, the reduction in the number of good muscle fibers and the whole muscle becomes weak. Duchenne Muscular Dystrophy

37. DNA, Chromosome Centromere, telomere, replication origin Nucleosome, Chromatin, Histone: H1, H2A, H2B, H3, H4 Histone octamer, DNA packaging DNA binding proteins, Histone modifications Summary

38. Histone proteins

39. HDAC HAT HDAC activity

40. מבנה הנוקלאוזום סיכת ביטחון

41. H2AH2B H3H4

42. Covalent Modification of core histone tails Acetylation of lysines (K) Mythylation of lysines Phosphorylation of serines (S) Histone acetyl transferase (HAT) Histone deacetylase (HDAC) Acetylation Mythylation epigenetics

43. 4 Penicillin mold 46Human 32Yeast42Macaque 40Mouse 38Cat 48Potato26Frog 20Algae16Planaria 20Corn8Fruit fly Species Total number of chromosomes/somatic (body) cell Dog 78 There is no connection between the number of chromosomes and the genome size, gene content, or any other feature of genomes. It is and essentially independent characteristic.

44. Cockayne syndrome group B (CSB) cells that fail to express CSB protein which causes profound neurological and developmental defects Blue – DNA White - gene

45. Chromosomal fragile sites are loci that are especially prone to forming gaps or breaks on metaphase chromosomes when cells are cultured under conditions that inhibit DNA replication or repair. The relationship of "rare" folate sensitive fragile sites with (CCG)n expansion and, in some cases, genetic disease is well established.

46. Fragile X syndrome What is Fragile X syndrome? Fragile X syndrome is the most common inherited cause of mental impairment, affecting approximately 1 in 2,000 males and 1 in 4,000 females worldwide. Cytogenetic analysis of metaphase spreads demonstrates the presence of the fragile site in less than 60% of cells in most affected individuals.). In 1991, the fragile X gene (FMR1) was characterized and found to contain a tandem repeated trinucleotide sequence (CGG) near its 5' end. The mutation responsible for fragile X syndrome involves expansion of this repeat segment. The number of CGG repeats in the FMR1 genes of the normal population varies from six to approximately 50. There are two main categories of mutation, premutations of approximately 50 to 200 repeats and full mutations of more than approximately 200 repeats. There is no clear boundary between the upper limit of normal and the lower limit of the premutation range. For this reason, alleles with approximately 45-55 copies of the repeat are said to be in the "grey zone." Some alleles in this size range are unstable and expand from generation to generation, while others are stably inherited. A premutation is susceptible to expansion after passage through a female meiosis. The larger the size of a woman's premutation, the more the risk of expansion to a full mutation in her offspring..

48. In man 10 4 to 10 5 sites a replication rate of 2 kb/minute

49. Origins of replication In E. coli only one site OriC In man 10 4 to 10 5 sites The direction of replication is bi-directional OriC

50. If this shoelace were a chromosome, then these two protective tips would be its The problem – DNA ends!

51. CHROMOSOME TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG AATCCCAATCCC 5’ 3’ TELOMERE The solution: adding repetitive sequences to the ends

52. T n A m G o type of minisatellite repeat TTAGGG – human TTTAGGG – Arabidopsis TTGGGG - Tetrahymena TTAGG – Bombyx TTTTAGGG – Chlamydomonas TTTTGGGG – Oxytricha TTAGGC - Ascaris (TG) 1-3 - Saccharomyces cereviceae

53. Telomere senescent cells have shorter telomeres length differs between species in humans 8-14kb long telomere replication occurs late in the cell cycle Telomeres are shortened by 40-to-200 bases between one cell division to the other.

54. Provide protection from enzymatic degradation and maintain chromosome stability Organization of the cellular nucleus by serving as attaching points to the nuclear matrix Allows end of linear DNA to be replicated completely Functions

55. End-to-end fusion

56. Telomerase 1.Telomerase binds to the telomer and the internal RNA component aligns with the existing telomer repeats. 2.Telomerase synthesizes new repeats using its own RNA component as a template 3.Telomerase repositions itself on the chromosome and the RNA template hybridizes with the DNA once more.

57. Telomerase is not active in most somatic cells

58. Cancer cells have telomerase

59. Dolly is aging too rapidly?….or was born 6 years old (telomers were 80% of normal sheep) Dolly has developed pre-mature arthritis

60. Werner Patient TeenagerAge 48