1. SARS Brian J Ward MDCM McGill Division of Infectious Diseases

2. Epidemic - World Parry J. BMJ 2003 Apr 19;326(7394):839 SARS shows no sign of coming under control. Severe Acute respiratory Syndrome (SARS)

3. Epidemic - World II Severe Acute respiratory Syndrome (SARS) China officially Acknowledges SARS problem

4. Epidemic - World III Severe Acute respiratory Syndrome (SARS) China - May 6, 2003 May 5, 2003 - 138 new cases 4,409 confirmed 2,646 suspected

5. Epidemic - Canada Severe Acute respiratory Syndrome (SARS)

6. Severe Acute Respiratory Syndrome (SARS) Chronology of Events Nov 27, 2002Mainland China - severe ‘flu’ noted Nov 02 - Feb 03Cases appearing in Guangdong province No official reports until Feb 2003 Feb 02, 2003First HC posting (FluWatch) Acute respiratory syndrome Feb 11, 2003Guangdong Dept Health - unknown virus 305 cases & 5 deaths Feb 13-23, 2003Elderly TO couple in Metropole Hotel Woman dies March 5, 2003 (ON1) Feb 23, 2003Hanoi outbreaks - index is American 20 HCW develop symptoms Feb 24, 2003Son of TO woman admitted (ON2)

7. Chronology of Events (con’t) Feb 28, 2003Hanoi - SARS identified by Dr C Urbani Feb 12-Mar 2, 2003Recognition of Metropole Hotel outbreak Prince of Wales Hosp (HK) outbreak in HCW Mar 3, 2003Daughter of ON1 develops symptoms Mar 5, 2003Wife of ON2 develops symptoms Mar 6, 2003BC resident (stayed at Metropole) admitted Mar 7, 2003Second son of ON1 develops symptoms Mar 9, 2003MD who cared for ON1-3 now sick Mar 12, 200370 HCW at PoW Hospital (HK) sick Mar 17, 2003WHO mobilizes 11 labs in 10 countries Ma 18, 2003German ID - metapneumovirus (MPV) by EM Mar 20, 200353 cases admitted to PoW Hospital (HK) Mar 21, 2003NML finds MPV in 6/8 cases Mar 23, 2003Scarborough Grace closes Mar 25, 2003Metropole records - 168 Canadians at risk Mar 27, 2003HK finds coronavirus - CDC confirms Mar 29, 2003HK chief MO hospitalized, Dr Urbani dies Apr 3, 2003WHO team gets permission to enter China Apr 7, 2003Amoy Gardens - entire complex in quarantine

8. Chronology of Events (con’t II) Apr 9, 2003Travel advisories - increased restrictions Apr 11, 2003NML finds coronavirus proteins by TMS Apr 12, 2003Michael Smith Genome Ctr - SARS genome Apr 14, 2003Singapore reports 80% decrease air traffic Apr 15, 2003Questions raised wrt ribavirin (HK Rx) Apr 16, 2003WHO announces ‘new’ pathogen Apr 17, 2003Risk/benefit warning wrt ribavirin Apr 19, 2003WHO announces droplet spread TO cases in HCW despite protective gear Apr 20, 2003Sunnybrook trauma/ICU closes Apr 21, 2003Finally - Chinese gov’t official recognition Apr 22, 2003CDC announces SARS can survive 24 hours CDC announces travel alert to TO China reports SARS in poor, inland sites Apr 23, 2003WHO includes TO in travel advisory Apr 30,2003CDN national meeting in TO re SARS May 1, 2003Nature - ribavirin dangerous

9. Chronology of Events (con’t) Feb 28, 2003Hanoi - SARS identified by Dr C Urbani Feb 12-Mar 2, 2003Recognition of Metropole Hotel outbreak Prince of Wales Hosp (HK) outbreak in HCW Mar 3, 2003Daughter of ON1 develops symptoms Mar 5, 2003Wife of ON2 develops symptoms Mar 6, 2003BC resident (stayed at Metropole) admitted Mar 7, 2003Second son of ON1 develops symptoms Mar 9, 2003MD who cared for ON1-3 now sick Mar 12, 200370 HCW at PoW Hospital (HK) sick Mar 17, 2003WHO mobilizes 11 labs in 10 countries Ma 18, 2003German ID - metapneumovirus (MPV) by EM Mar 20, 200353 cases admitted to PoW Hospital (HK) Mar 21, 2003NML finds MPV in 6/8 cases Mar 23, 2003Scarborough Grace closes Mar 25, 2003Metropole records - 168 Canadians at risk Mar 27, 2003HK finds coronavirus - CDC confirms Mar 29, 2003HK chief MO hospitalized, Dr Urbani dies Apr 3, 2003WHO team gets permission to enter China Apr 7, 2003Amoy Gardens - entire complex in quarantine Published online - Lancet Apr 8, 2003 Peiris JSM, et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 2003;361:1319 50 cases coronavirus isolated from 2/50 serology and/or PCR positive in 45/50 no coronavirus in controls

10. Epidemiology - Initial Data Severe Acute respiratory Syndrome (SARS) initial information limited due to Chinese policies data from Hanoi, HK, Toronto, Taiwan - HCW at markedly increased risk - barrier precautions appeared to be effective - mask (N95), gowns, gloves & visors - quarantine little evidence of airborne transmission ‘droplet’ transmission suspected nothing known about environment nothing known about infectiousness - very sick more infectious (? ‘superspreaders’) - probably not infectious before symptomatic

11. Epidemiology - Amoy Gardens Severe Acute respiratory Syndrome (SARS) Amoy Gardens Appartment Complex (Hong Kong) 131 cases of SARS (block E residents) 241 asymptomatic residents quarantined ariborne, droplet, water, environmental (cockroaches), etc early index case with diarrhea lived on top floors virtually all subsequent cases on same ‘side’ of complex (same elevator, banisters, air ducts, etc) apparently ‘leak’ in sewage pipes so feces from index ‘dried’ on pipes and ?? blown into building

12. There are only 3 certainties in life... Death Taxes That rents have gone down at the Amoy Gardens Apartment Complex

13. Etiology Severe Acute respiratory Syndrome (SARS) initial report (CDN NML) - metapneumovirus (PCR) - 6 of first 8 cases - seen occasionally by other laboratories - metapneumovirus activity in Hong Kong report of Chlamydia spp from Germany subsequent reports by US CDC & HK (EM) - morphologically consistent with coronavirus - rapid development of culture systems & PCR - confirmed presence of a coronavirus in most (but not all) patients

14. Etiology - II Severe Acute respiratory Syndrome (SARS) CDN National Microbiology Laboratory - coronavirus isolation or PCR positive (respiratory) 75 50 25 0 SARS confirmed SARS probable Non-SARS

15. Etiology - III Severe Acute respiratory Syndrome (SARS) Various laboratories - Early isolation from respiratory tract (~50%) - >85% isolation from feces later in infection - Shedding of virus for ? days after resolution Erasmus University - two monkeys (Rhesus macaques) - intra-tracheal Vero cell supernatant - 1/2 animals developed ‘viral pneumonia’ - ? satisfies Koch’s postulates - currently being replicated at NML & CDC among others - ? Animal model for SARS

16. Coronaviridae - Virology Severe Acute respiratory Syndrome (SARS) enveloped, single-stranded + sense RNA viruses largest RNA viruses (27-32 kb) 2 genera - coronavirus - torovirus 3 antigenic coronavirus groups difficult to isolate - happiest on primary cells genetically labile normally narrow host & tissue specificity replicate in cytoplasm

17. Coronaviridae - Virology II Severe Acute respiratory Syndrome (SARS) Group I HCoV-229Ehumanhuman respiratory coronavirus TGEV, PRCoVpigporcine transmissible gastroenteritis virus CCoVdogcanine respiratory coronavirus FECoVcatfeline enteric coronavirus FICoVcatfeline infectious peritonitis virus RbCoVrabbit rabbit respiratory coronavirus Group II HCoV-)C43humanhuman respiratory coronavirus MHVmousemurine hepatitis virus SDAVratsialodacryoadenitis virus HEVpigporcine hemagglutinating virus BCoVcowbovine respiratory coronavirus TCoVturkeyturkey respiratory coronavirus Group III IBVchickenavian bronchitis virus TCoVturkeyturkey respiratory coronavirus

18. Coronaviridae - Virology III Severe Acute respiratory Syndrome (SARS) 66% of genome devoted to polymerase gene (2 overlapping ORFs) produce nested set of mRNAs Spike, E and HE embedded in lipid bilayer (surface proteins) M also embedded (3 loops through bilayer) S binds to host cell receptor & induces fusion antibodies against S neutralize virus HE only in some sero-group II viruses HE has 30% homology to influenza C hemagglutinin (HA) 3’5’ leader (65-98nt) 5’ UTR Polymerase Spike E M N 3’ UTR AA…. Hemagglutinin-Esterase (HE)

19. Virology IV Severe Acute respiratory Syndrome (SARS) mutations spread evenly throughout genome NOT an obvious recombination virus a ‘new’ agent Murine Hepatitis Virus ML-11 Murine Hepatitis Virus Murine Hepatitis Virus - Strain 2 Murine Hepatitis Virus Murine Hepatitis Virus - Strain JHM Bovine coronavirus SARS agent - HK isolate Avian infectious bronchitis virus Avian infectious bronchitis virus - Strain CK Transmissible gastroenteritis virus Human coronavirus 229E Porcine epidemic diarrhea virus Peiris JSM et al. Lancet 2003

20. Coronaviridae - Biology Severe Acute respiratory Syndrome (SARS) normally highly host- & tissue-specific likely that many mammals have coronavirues - implications for ‘search’ for SARS reservoir species stability of coronaviruses? - BCoV vaccine (1980’s) still works - RNA virus (~1 error/10,000 bases or 3 errors/replication) - tissue culture passage (MHV) relatively few mutations - antibody pressure many more mutations recombination possible (in vitro and in nature) - TGEV ‘evolved’ to PRCoV in Europe in 1980s - large deletion in S protein gene - similarly FECoV ‘evolved’ into FIPV

21. Coronaviridae - Biology II Severe Acute respiratory Syndrome (SARS) recombination accomplished by - discontinuous transcription - polymerase ‘jumping’ pol ATTCCAGATTATCGATTAGCGGAT Genomic Virus A GGCAATTATATCGGACTTAGAACCGA Genomic Virus B pol ATTCCAGATTGACTTAGAACCGA Chimeric A/B Virus

22. Coronaviridae - Immunity Severe Acute respiratory Syndrome (SARS) Adults have partial protection from coronaviruses Vaccines have been developed for other viruses Role of immune response in ‘disease’ unknown Timing of vaccine development effort If virus has just ‘jumped’ to man - expect rapid mutation to adapt to human host - mutations could go in any direction less pathogenic more pathogenic different pathogenesis

23. Clinical Disease Severe Acute respiratory Syndrome (SARS) Case Definition measured temperature of >100.4°F At least one finding of respiratory disease - cough, SOB, difficulty breathing, hypoxia, Xray) travel within 10 days of symptom onset to at risk area - excluding areas with secondary spread only to HCW & household contacts Contact within 10 days of symptom onset with traveller returned from risk area and respiratory illness or case of suspected SARS

24. Clinical Features Severe Acute respiratory Syndrome (SARS) (first 10 cases) Fever100% Nonproductive cough100% Dyspnea 80% Malaise 70% Diarrhea 50% Chest pain 30% Headache 30% Myalgias 20% Vomiting 10% Infiltrate on CXR 90% Oxygen saturation <95% 78% Poutanen SM et al. NEJM Apr 2003 Children may be Less affected by SARS than adults

25. SARS AP showing extensive bilateral ground-glass Opacities and poorly defined nodular pattern. Nicolaou S et al. AJR Am J Roentgenol. 2003;180:1247-9 55-year-old healthy man with history of recent travel to Hong Kong. 12 hours later Clinical Disease - Imaging

26. Mortality Rate? Severe Acute respiratory Syndrome (SARS) Don’t Really Know estimates between 2-8% Canada among the highest estimates USA - expect at least 3 deaths but 0/53 Need serologic (or other) test for denominator Hospital-based outbreak (CDN) will increase estimate Community-based (HK) or sporadic (US) will lower Rate in children may be lower Even if 2% is true estimate 0.02 (5x10 )= 1x10 deaths 98

27. SARS & Ribavirin Primum non nocere (first, do no harm) Severe Acute respiratory Syndrome (SARS) second … beware of 20/20 hindsight enormous pressure to ‘do something’ first ‘bugs’ = metapneumovirus & Chlaydia spp ribavirin/antibiotics appropriate ?? of ARDS made ribavirin-steroid combo ‘logical’ ribavirin acts vs coronaviruses only at toxic doses recommendation note to use - end April, 2003

28. Therapeutic Options Severe Acute respiratory Syndrome (SARS) progression variable symptoms pronounced some have ‘saddleback’ presentations - apparent recovery - subsequent decline - ARDS-like presentations ?? viral pneumonia vs immune attack?? - no anti-viral know to be effective - do not use ribavirin - steroids probably a bad idea (unless ARDS likely) supportive care

29. Epidemiology - Current Data Severe Acute respiratory Syndrome (SARS) coronavirus can live 24-48 hours on objects can live in feces for at least 2 days (diarrhea - 4 days) most respiratory route but mucosa possible ?? initial viremia with widespread distribution both gut and respiratory epithelium infected many subjects shed virus from respiratory tissues virtually all subjects shed virus in feces shedding (after recovery) can be prolonged ?? epidemiology in HIV-infected subjects incubation period 2-10 days inoculum effect - high dose, early & bad disease some procedures very high risk - intubation in conscious patient

30. Current Status (World) Severe Acute respiratory Syndrome (SARS) SARS controlled everywhere except China complicated blizzard of travel advisories - new visa requirements - exclusions - ‘alerts’ vs ‘advisories’ vs bans - all levels of ‘authority’ have made pronouncements China now apparently more ‘transparent’ WHO actions may paradoxically decrease compliance - but they had no choice - only real criticism wrt Canada was timing (ie: slow) most experts believe SARS now ‘endemic’ in China

31. Current Status (China) Severe Acute respiratory Syndrome (SARS) massive increases in SARS cases - Beijing: 37 cases 10 days ago - Beijing: almost 3,000 cases (May 6, 2003) rapid spread (or acknowledgement of presence) - rural provinces (migrant workers escaping Beijing) - south to north - coast to Mongolia WHO teams now in Guangdong, Beijing and northern province (? Herxe) due to explosive growth of case reports widespread panic, rural communities establishing own quarantine, killing pets

32. Current Status (Canada) Severe Acute respiratory Syndrome (SARS) SARS controlled in BC & Toronto First SARS meeting (April 30 - May 1, 2003) Major recommendations - create National Public Health Authority - create National Public Health capacity (CDC-like) - need resources to be mobilized faster than CIHR - human resources pitifully limited - need trainees at all levels - need National (research) SARS think ‘tank’ - research priorities organized immediate medium term long-term vaccine

33. Current Status (Science) Severe Acute respiratory Syndrome (SARS) coronavirus likely to be etiologic agent knowing reservoir would be helpful need (small) animal model need rapid diagnostic test (extent of disease, mortality) - classical EIA - antigen-detection ?? immunity & immunopathogenesis ?? - antibodies are produced & can neutralize (others) - role of cell-mediated immunity (help or harm) - immunologic memory (vaccines possible for others) - above will dictate vaccine development novel anti-virals possible - polymerase can be targeted

34. Current Status (McGill) Severe Acute respiratory Syndrome (SARS) RVH designated as SARS site (if needed) Has the most negative-pressure rooms SARS ‘team’ - infection control - infectious diseases - respiratory medicine Clinics encouraged to screen by phone & questions Possible cases sent to ER at RVH (or other sites) Barrier precautions (immediate) + environmental decontamination Immediate involvement of public health