1. Modeling hominid relationships

2. Engage
Did humans evolve from modern apes, or do modern apes and humans have a common ancestor?
Explain your understanding of the difference between these two questions to your partner.

3. Explore
The ape family is composed of gibbons, orangutans, chimpanzees, and gorillas. Chimpanzees and gorillas represent the African side of the family; gibbons and orangutans represent the Asian side of the family. The apes we will work with in this activity are the chimpanzee and the gorilla.

4. Characteristics of Apes and Humans
Posture
Bent over or qudrupedal (“knuckle-walking” common
Upright or bipedal
Leg & arm length
Arms longer than legs; arms adapted for swinging, usually among trees
Legs usually longer than arms; legs adapted for striding
Feet
Low arches; opposable big toes, capable of grasping
High arches; big toes in line with other toes; adapted for walking
Teeth
Prominent teeth; large gaps between canines and nearby teeth
Reduced teeth; gaps reduced or absent
Skull
Bent forward from spinal column; rugged surface; prominent brow ridges
Held upright on spinal column; smooth surface
Face
Sloping; jaws jut out; wide nasal opening
Vertical profile; distinct chin; narrow nasal opening
Brain size
280 to 705 cm3 (living species)
200 to 2000 cm3 (fossil to present)
Age at puberty
Usually years
Usually 13 years or older
Breeding season
Estrus at various times
Continual

5. Evolutionary relationships among organisms from comparisons of skeletons and other characteristics
Morphological tree

6. Explore
How can you use this data to determine relationships among humans, apes, and other animals.
Are structures similar because they carry out the same functions or because they were inherited from a common ancestor?

7. Explain
Find the part of the tree that shows the relationships between gorillas, chimpanzees, and humans. Notice that there are no lines showing relationships.
Develop three hypotheses to explain how these organisms are related. Make a tree diagram of the hypotheses by drawing lines from point A to each of the three organisms (G=gorilla, C=chimpanzee, H=human, A= common ancestor.

8. Possible evolutionary relationships
Hypothesis 1
Hypothesis 2
Hypothesis 3

9. Elaborate
Modern research techniques allow biologists to compare the DNA the codes for certain proteins and to make predictions about the relatedness of the organisms from which they took the DNA. You will use models of these techniques to test your hypotheses and determine which one is best supported by the data you develop.

10. Elaborate procedure Step 1
Working in groups of four, “synthesize” strands of DNA according to the following specifications. Each different color of paper clip represents one of the four bases of DNA:
Black = adenine
White = thymine
Green = guanine
Red = cytosine
Each group member will synthesize one strand of DNA. (The first nucleic acid is designated as position 1, the last as position 20)
Group member 1 (Human DNA)
AGGCATAAACCAACCGATTA
Group member 2 (Chimpanzee DNA)
AGGCCCCTTCCAACCGATTA
Group member 3 (Gorilla DNA)
AGGCCCCTTCCAACCAGGCC
Group member 4 (Common ancestor DNA)
AGGCCGGCTCCAACCAGGCC

11. Elaborate procedure
These strands represent a small section of the gene that codes for the hemoglobin protein. In the case of the common ancestor the sequence is from hypothetical data since no such DNA exists.
Step 2
Compare the human DNA to the Chimpanzee DNA by matching the strands base by base.
Step 3
Count the number of bases that are not the same. Record the data in a table. Repeat these steps with human DNA and the gorilla DNA.

12. Evaluate
How do the gorilla DNA and the chimpanzee DNA compare with the human DNA?
What do these data suggest about the relationship between humans, gorillas, and chimpanzees?
Do the data support any of your hypotheses? Why or why not?

13. Evaluate
Biologists have determined that some mutations in DNA occur at a regular rate and can use this rate as a “molecular clock” to predict when two organisms began to separate from a common ancestor.
Evolutionary biologists often disagree about the tempo of evolutionary change and about the exact nature of speciation and divergence.
Models are useful tools for testing different hypotheses proposed by biologists.

14. Evaluation procedure
Which DNA is most similar to the common ancestor DNA?
Which two DNAs were most similar in the way that they compared to the common ancestor DNA?
Which of the hypotheses developed previously do your data best support?
Do your findings prove that this hypothesis is correct? Why or why not/

15. Evaluation procedure
Based on the hypothesis that your data best supported, which of the following statements is most accurate?
Humans and apes have a common ancestor?
Humans evolved from apes?
Based on all of the data collected, which of the following statements is most accurate?
Chimpanzees and humans have a common ancestor.
Chimpanzees are the direct ancestors of humans.
A comparison of many more DNA sequences indicates that human DNA and chimpanzee DNA are 98.8% identical. What parts of your data support this result?