Download presentation
Presentation is loading. Please wait.
Published bySherman Nichols Modified over 9 years ago
1
Hybridization of Nucleic Acids RNA DNA1DNA2 Probe Southern hybridization Northern hybridization Juang RH (2004) BCbasics
2
Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-SER-VAL-LEU----- GGG-GAC-GAG-TCC-TCC-GTT-CTC--- Nucleic acid sequence * Codon degeneracy * * * * * * * Synthesizing oligonucleotide PROBE: GGGGACGAGTCCTCCGTTCT The nucleic acid sequence is Deduced from amino acid sequence Chemical synthesis Juang RH (2004) BCbasics
3
Target gene DNA denaturation Single colony Lysed Hybridization Probe is labeled with radioactive 32 P Juang RH (2004) BCbasics
4
Colony Is Screened by Hybridization with Probe Cover with filter paper Autoradiography Add probe Transferring … Collect filter paper Dissolve cell DNA denatured Juang RH (2004) BCbasics Colony hybridization
5
Sample DNA Each spot contains known DNA Biochip Schena (2000) Microarray Biochip Technology, p. A31 Complementary DNA hybridize Signal appears Biochip Based on Hybridization Juang RH (2004) BCbasics
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.