1. Molecular diagnosis of heterogeneous genetic diseases: the example of muscular dystrophies Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine (TIGEM)

2. What is a mutation? A variation of the DNA sequence that is only found in affected individuals that is only found in affected individuals that is never found in non affected individuals that is never found in non affected individuals that accounts for the pathological process/status that accounts for the pathological process/status that, when corrected in time, disease is rescued that, when corrected in time, disease is rescued

3. ..that is only found in affected and that is never found in non affected incomplete penetrance that is more often found in affected than in non affected...

4. 50.000 private variants = innocuous differences belonging to one family CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

5. 1-allele diseases monoallelic mutations may be responsible for dominant or X-linked disorders monoallelic mutations may be responsible for dominant or X-linked disorders new random mutations are the rule with an unpredictable pattern of distribution new random mutations are the rule with an unpredictable pattern of distribution

6. Gender effect in mutations For mutations other than point mutations, sex biases in the mutation rate are very variable For mutations other than point mutations, sex biases in the mutation rate are very variable Small deletions are more frequent in females Small deletions are more frequent in females Germline base substitution mutations occur more frequently in males than in females, especially in older males Germline base substitution mutations occur more frequently in males than in females, especially in older males Point mutations at some loci occur almost exclusively in males, whereas others occur ten times more than in females Point mutations at some loci occur almost exclusively in males, whereas others occur ten times more than in females

7. Relative frequency of de novo achondroplasia for different paternal ages

8. Relative frequency of de novo neurofibromatosis for different paternal ages Relative frequency of de novo neurofibromatosis for different paternal ages

9. the number of male germ-cell divisions

11. 2-allele diseases novel mutations are rare, usually mutations have a long history (100-1000 generations) novel mutations are rare, usually mutations have a long history (100-1000 generations) mutations have an ethnical signature with a predictable pattern of distribution and frequency mutations have an ethnical signature with a predictable pattern of distribution and frequency biallelic mutations may be responsible for autosomal recessive disorders biallelic mutations may be responsible for autosomal recessive disorders polymorphisms and private variants are more easily discriminated vs true mutations polymorphisms and private variants are more easily discriminated vs true mutations

12. 2-allele diseases consanguineity is a risk factor for homozygosity consanguineity is a risk factor for homozygosity high carrier frequency is a risk factor for compound heterozygosity high carrier frequency is a risk factor for compound heterozygosity

13. The effect of an allele null or amorph = no product null or amorph = no product hypomorph = reduced amount / activity hypomorph = reduced amount / activity hypermorph = increased amount / activity hypermorph = increased amount / activity neomorph = novel product / activity neomorph = novel product / activity antimorph = antagonistic product / activity antimorph = antagonistic product / activity

14. Dominant or recessive phenotype?

15. Loss of function mutations in the PAX3 gene (Waardenburg syndrome) haploinsufficiency

16. amorph / hypomorph (1) deletion deletion –the entire gene –part of the gene disruption of the gene structure disruption of the gene structure –by insertion, inversion, translocation promoter inactivation promoter inactivation mRNA destabilization mRNA destabilization splicing mutation splicing mutation –inactivating donor/acceptor –activating criptic splice sites

17. amorph / hypomorph (2) frame-shift in translation frame-shift in translation –by insertion of n+1 or n+2 bases into the coding sequence –by deletion of n+1 or n+2 bases into the coding sequence nonsense mutation nonsense mutation missense mutation / aa deletion missense mutation / aa deletion –essential / conserved amino acid –defect in post-transcriptional processing –defect in cellular localization

19. hypermorph trisomia trisomia duplication duplication amplification (cancer) amplification (cancer) chromatin derepression (FSH) chromatin derepression (FSH) trasposition under a strong promoter trasposition under a strong promoter –leukemia overactivity of an abnormal protein overactivity of an abnormal protein

20. neomorph generation of chimeric proteins generation of chimeric proteins duplication duplication amplification (cancer) amplification (cancer) missense mutations missense mutations inclusion of coding cryptic exons inclusion of coding cryptic exons usage of alternative ORFs usage of alternative ORFs overactivity of an abnormal protein overactivity of an abnormal protein

21. antimorph missense mutations missense mutations inclusion of coding cryptic exons inclusion of coding cryptic exons usage of alternative ORFs usage of alternative ORFs

23. Mutation detection mutation scanning mutation scanning –or resequencing methods for identifying previously unknown mutations genotyping genotyping –methods for scoring previously known mutations or single nucleotide polymorphisms (SNPs)

24. Key questions for mutation detection strategy expected mutations are monoallelic or biallelic? is the gene well recognized for that disease? is the mutation pattern known? (deletion, dup, small mutations, etc.) which is the complexity of the gene? how many patients must be examined? how many controls should be examined? how many mutations and how many variations have already been identified in this gene? are there more members of the same gene family (or pseudogenes) in the genome?

25. Gene size Number of patients X Number of controls Dimension of the mutation detection study

26. frequent mutations are known? mutationscanning SEQUENCING screening of recurrent mutations mutations YES NO mutations are identified? YES NO General strategy for mutation detection

27. DMD Duchenne Muscular Dystrophy - 1/3,500 boys Onset -- Early childhood - about 2 to 6 years DMD Duchenne Muscular Dystrophy - 1/3,500 boys Onset -- Early childhood - about 2 to 6 years –Laboratory -- CK (50x to 1.000x), LDH5, ALT, AST, aldolase increase Symptoms -- Generalized weakness and muscle wasting affecting proximal limb muscles first. Calves often enlarged. Heart involvement Progression -- Disease progresses slowly but will affect all voluntary muscles. Survival possible beyond late twenties BMD Becker Muscular Dystrophy - 1/10,000 boys Onset -- Adolescence or adulthood Symptoms -- Almost identical to Duchenne but often much less severe. Heart involvement Progression -- Slower and more variable than DMD with survival well into mid to late adulthood BMD Becker Muscular Dystrophy - 1/10,000 boys Onset -- Adolescence or adulthood Symptoms -- Almost identical to Duchenne but often much less severe. Heart involvement Progression -- Slower and more variable than DMD with survival well into mid to late adulthood

28. Carrier of a balanced reciprocal X-autosome translocation

34. Dystrophin gene: page 1/185

35. Dystrophin gene: page 2/185

36. Dystrophin gene: page 3/185

37. Dystrophin gene: page 185/185

38. more DNA Telethon-UILDM 250/300 DMD/BMD Qualitative test Quantitative test rejected 80plex-PCR Deletions duplications Point mutations mRNA study Family tests

39. DMD AB BMD C D DMD patient : groups A, B BMD patient : groups C, D Deletion ex 17-43 Duplication ex 13-23 Log-PCR = 4 multiplex-PCR (2x20+2x18) with uniform spacing and gel position according to chromosomal position 1 2 3 4 5 6 1: del ex 43 2: del ex 11, 17, 19, 21 3: del ex 17, 19, 21 4: del ex 50, 52 5: del ex 7, 11, 17, 19 6: del ex 61 1: no del 2: del ex 8, 12, 18, 20, 22 3: del ex 12, 18, 20, 22 4: del ex 46, 51 5: del ex 6, 8, 12, 18 6: del ex 62

40. large deletions in 377/506 DMD/BMD 74.5%

41. large duplications in 51/506 patients 10.1%

42. SALSA MLPA probes

43. Hybridysation 1. 1. The MLPA probemix is added to denatured genomic DNA 2. 2. The two parts of each probe hybridise to adjacent target sequences

44. Ligation 3. Probes are ligated by a thermostable ligase

45. PCR amplification 4. A universal primer pair is used to amplify all ligated probes The PCR product of each probe has a unique length (130 480 bp)

46. Separation and quantification by capillary electrophoresis Each peak is the amplification product of a specific probe. Samples are compared to a control sample. A difference in relative peak height or peak area indicates a copy number change of the probe target sequence

47. MRC-Holland b.v. Triple X Female Male 283 bp 346 bp Detection of Chr X copy number X

48. MLPA discriminates sequences that differ in only a single nucleotide and can be used to detect known mutations. MismatchPerfect match Ligation of the two probe oligonucleotides  Amplification product Mismatch at the probe ligation site  No ligation, no amplification product

49. MRC-Holland b.v. Unmethylated Target M M Methylated Target Denaturation and Multiplex probe hybridization M Only undigested (methylated) and ligated probes are exponentially amplified Ligation and Digestion with methylation sensitive endonucleases M MS-MLPA

50. Limb-girdle weakness proximal weakness: most common Lower extremities Lower extremities –difficulty climbing stairs –arising from a low chair or toilet –getting up from a squatted position Upper extremities Upper extremities –trouble lifting objects over their head –brushing their hair distal weakness distal weakness –difficulty opening jars, inability to turn a key in the ignition, or tripping due to foot drop cranial weakness cranial weakness –dysarthria, dysphagia or ptosis

51. Genetics of limb-girdle muscular dystrophies autosomal dominant autosomal dominant LGMD1A5q31.2myotilin (Hauser, 2000) LGMD1A5q31.2myotilin (Hauser, 2000) LGMD1B1q21lamin A/C (Bonne, 1999) LGMD1B1q21lamin A/C (Bonne, 1999) LGMD1C3p25.3caveolin 3 (Minetti, 1997) LGMD1C3p25.3caveolin 3 (Minetti, 1997) LGMD1D6q22 ? LGMD1D6q22 ? LGMD1E7q35 ? LGMD1E7q35 ? LGMD1F7q31.1filamin C LGMD1F7q31.1filamin C LGMD1G4p21? LGMD1G4p21? autosomal recessive autosomal recessive LGMD2A15q15calpain 3 (Richard, 1995) LGMD2A15q15calpain 3 (Richard, 1995) LGMD2B2p13.2dysferlin (Bashir, Liu, 1998) LGMD2B2p13.2dysferlin (Bashir, Liu, 1998) LGMD2C13q12  -sarcoglycan (Noguchi, 1995) LGMD2C13q12  -sarcoglycan (Noguchi, 1995) LGMD2D17q21.33  -sarcoglycan (Roberds, 1994) LGMD2D17q21.33  -sarcoglycan (Roberds, 1994) LGMD2E4q12  -sarcoglycan (Bonnemann, Lim, 1995) LGMD2E4q12  -sarcoglycan (Bonnemann, Lim, 1995) LGMD2F5q33  -sarcoglycan (Nigro, 1996) LGMD2F5q33  -sarcoglycan (Nigro, 1996) LGMD2G17q12telethonin (Moreira, 2000) LGMD2G17q12telethonin (Moreira, 2000) LGMD2H9q33.1TRIM 32 (Frosk, 2002) LGMD2H9q33.1TRIM 32 (Frosk, 2002) LGMD2I19q13.3FKRP (Brockington, 2001) LGMD2I19q13.3FKRP (Brockington, 2001) LGMD2J2q24.3titin (Udd, 2002) LGMD2J2q24.3titin (Udd, 2002) LGMD2K9q34.1POMT1 (Balci, 2005) LGMD2K9q34.1POMT1 (Balci, 2005) LGMD2L9q31fukutin (Godfrey, 2006) LGMD2L9q31fukutin (Godfrey, 2006) LGMD2M11p13-p12? LGMD2M11p13-p12?

53. autosomal dominant forms (LGMD1) are generally milder autosomal dominant forms (LGMD1) are generally milder represent less than 10% of all LGMD represent less than 10% of all LGMD marked heterogeneity for LGMD1, one gene per one single family marked heterogeneity for LGMD1, one gene per one single family autosomal dominant

54. autosomal recessive autosomal recessive forms (LGMD2) have an average prevalence of 1:14,000-1:20,000 at birth autosomal recessive forms (LGMD2) have an average prevalence of 1:14,000-1:20,000 at birth frequency differences among countries frequency differences among countries this depends on higher carrier frequencies of single mutations, as 550delA for calpain 3 in Croatia, L276I for FKRP in Northern Europe, 521delT for gamma-sarcoglycan in Northern Africa this depends on higher carrier frequencies of single mutations, as 550delA for calpain 3 in Croatia, L276I for FKRP in Northern Europe, 521delT for gamma-sarcoglycan in Northern Africa At least 25% of families are excluded from any known locus and 40% of typical LGMD cases have no mutation in any known gene At least 25% of families are excluded from any known locus and 40% of typical LGMD cases have no mutation in any known gene

55. Tools to address the diagnosis of LGMD Clinical presentation (MRI) Clinical presentation (MRI) WB analysis WB analysis Segregation study Segregation study Mutation detection in patients Mutation detection in patients Mutation detection in normal subjects Mutation detection in normal subjects Homogeneous collection of mutations and polymorphisms Homogeneous collection of mutations and polymorphisms

56. Segregation analysis Analysis of 30 polymorphic markers linked to LGMD2A, 2B, 2C-2F, 2I in sib pairs Analysis of 30 polymorphic markers linked to LGMD2A, 2B, 2C-2F, 2I in sib pairs To find homozigosity… To find homozigosity…

57. Calpain 3 24 exons dysferlin 55 exons  -sarcoglycan 8 ex (10) FKRP 4 esons (8) Telethonin 2 exons (3) TRIM32 1 exons (7) Titin 363 ex (35)  -sarcoglycan 10 exons  -sarcoglycan 6 ex (7)  -sarcoglyican 9 exons Myotilin 9 exons Lamin A/C 13 exons Caveolin 3 2 exons (3)

58. Case 1 The gene is known The gene is known It is composed of five small size exons It is composed of five small size exons There are 10 patients, sons of consanguineous parents There are 10 patients, sons of consanguineous parents Expected mutations are homozygous Expected mutations are homozygous Mutations have never been identified in this gene Mutations have never been identified in this gene There is no other member of the same gene families (or pseudogenes) in the genome There is no other member of the same gene families (or pseudogenes) in the genome

59. Case 2 The gene is known The gene is known The putative function of the gene product is to serve as a transcription factor The putative function of the gene product is to serve as a transcription factor Expected mutations are dominant Expected mutations are dominant Mutations have never been identified in this gene Mutations have never been identified in this gene There are other members of the same gene families (or pseudogenes) in the genome There are other members of the same gene families (or pseudogenes) in the genome

60. Sequencing With the ongoing reduction of costs (today about 2-4 €/run), sequencing of PCR products is applied for mutation detection With the ongoing reduction of costs (today about 2-4 €/run), sequencing of PCR products is applied for mutation detection Sequencing is often thought of as the 'gold standard' for mutation detection. Sequencing is often thought of as the 'gold standard' for mutation detection. This perception is distorted due to the fact that this is the only method of mutation identification, but this does not mean it is the best for mutation detection This perception is distorted due to the fact that this is the only method of mutation identification, but this does not mean it is the best for mutation detection

61. Sequencing artifacts FALSE POSITIVE (specificity) –when searching for heterozygous DNA differences there are a number of potential mutations, together with sequence artifacts, compressions and differences in peak intensities that must be re- checked with additional primers and costs FALSE NEGATIVE (sensitivity) –loss of information farther away or closer to the primer –does not detect a minority of mutant molecules in a wild-type environment

62. Current mutation scanning techniques SSCP (single strand conformation polymorphism) SSCP (single strand conformation polymorphism) HA (heteroduplex analysis) HA (heteroduplex analysis) CCM (chemical cleavage of mismatch) CCM (chemical cleavage of mismatch) CSGE (conformation sensitive gel electrophoresis) CSGE (conformation sensitive gel electrophoresis) DGGE (denaturing gradient gel electrophoresis) DGGE (denaturing gradient gel electrophoresis) DHPLC (denaturing HPLC) DHPLC (denaturing HPLC) PTT (protein truncation test) PTT (protein truncation test) DGCE (denaturing gradient capillary electrophoresis) DGCE (denaturing gradient capillary electrophoresis) direct sequencing direct sequencing

63. SSCP

64. Mutation detection by heteroduplex analysis: the mutant DNA must first be hybridized with the wild-type DNA to form a mixture of two homoduplexes and two heteroduplexes

65. Heteroduplex analysis

66. DHPLC denaturing HPLC from Transgenomic

67. DHPLC analysis at different temperatures of the column

68. Analysis of dystrophin exon 59 Homoduplex DNA: PCR fragments are identicals Heteroduplex DNA: PCR fragments are different

69. DHPLC analysis of the CAPN3 gene (exon 11) UV 02 FLUO 0 100 1:21:41:61:81:10

70. POOLED PLATES A+B PLATE A PLATE B DHPLC analysis

72. PTT protein truncation test Sensitivity 1000-bp fragment > 85% Sensitivity 1000-bp fragment > 85% Detects only nonsense mutations Detects only nonsense mutations Post PCR time: 48-72 hours (translation/trascription, gel preparation, loading and run, analysis of results) Post PCR time: 48-72 hours (translation/trascription, gel preparation, loading and run, analysis of results) Use of 35S radioactivity Use of 35S radioactivity No special equipment required No special equipment required mRNA as starting template mRNA as starting template

75. Applications of PTT (% of truncating mutations) Polycystic Kidney Disease PKD1 95% Polycystic Kidney Disease PKD1 95% Familial Adenomatous Polyposis APC 95% Familial Adenomatous Polyposis APC 95% Ataxia telangiectasia ATM 90% Ataxia telangiectasia ATM 90% Hereditary breast and ovarian cancer BRCA1-290% Hereditary breast and ovarian cancer BRCA1-290% Duchenne Muscular Dystrophy DMD 90%? Duchenne Muscular Dystrophy DMD 90%? Fanconi anemia FAA80% Fanconi anemia FAA80% Hereditary non-polyposis colorectal cancer hMSH1-2 70%- 80% Hereditary non-polyposis colorectal cancer hMSH1-2 70%- 80% Neurofibromatosis type 2 NF2 65% Neurofibromatosis type 2 NF2 65% Hunter Syndrome IDS50% Hunter Syndrome IDS50% Neurofibromatosis type 1 NF1 50% Neurofibromatosis type 1 NF1 50% Cystic Fibrosis CFTR15% Cystic Fibrosis CFTR15%

76. Molecular inversion probe (MIP) genotyping MIP genotyping uses circularizable probes with 5′ and 3′ ends that anneal upstream and downstream of the SNP site leaving a 1 bp gap Polymerase extension with dNTPs and a non-strand- displacing polymerase is used to fill in the gap

77. Ligation seals the nick, and exonuclease I is used to remove excess unannealed and unligated circular probes The resultant product is PCR-amplified and the orientation of the primers ensures that only circularized probes will be amplified The resultant product is hybridized and read out on an array of universal-capture probes

78. GoldenGate uses extension ligation between annealed locus-specific oligos (LSOs) and allele- specific oligos (ASOs) An allele-specific primer extension step is used to preferentially extend the correctly matched ASO (at the 3′ end) up to the 5′ end of the LSO primer Ligation then closes the nick GoldenGate genotyping assay

79. A subsequent PCR amplification step is used to amplify the appropriate product using common primers to ‘built-in’ universal PCR sites in the ASO and LSO sequences A subsequent PCR amplification step is used to amplify the appropriate product using common primers to ‘built-in’ universal PCR sites in the ASO and LSO sequences The resultant PCR products are hybridized and read out on an array of universal-capture probes The resultant PCR products are hybridized and read out on an array of universal-capture probes GoldenGate genotyping assay

80. 454 technology: DNA fragmentation and adaptor ligation

81. 454 technology: a water-in-oil emulsion is created: a single molecule of DNA with a single bead

82. 454 technology: Beads with clones are selected and assembled onto a planar substrate

83. 454 technology: Sequencing by synthesis pyrosequencing Up to 100 Million bp in 8 hours can be read Ambiguities arise for homopolymeric tracts

84. 7.4 x coverage 234 runs 24.5 billions bp

85. 11 genetic diseases !!

86. NimbleGen sequence capture