1. Reverse Genetics of RNA Viruses Chang Won Lee, DVM, Ph.D. Lee.2854@osu.edu Phone: 330-263-3750 VPM 700 May’06

2. Reverse Genetics (RG) The creation of a virus with a full- length copy of the viral genome The creation of a virus with a full- length copy of the viral genome The most powerful tool in modern virology The most powerful tool in modern virology VPM 700 May’06

3. RG of RNA viruses Generation or recovery (rescue) of infectious virus from cloned cDNA Generation or recovery (rescue) of infectious virus from cloned cDNA RNA cDNAinfectious virus “Infectious Clone” VPM 700 May’06 In vitro-transcribed RNA cDNA in vector OR

4. Nature of RNA viruses Polarity (+ sense or – sense) Polarity (+ sense or – sense) Size of the genome Size of the genome Segmented or not Segmented or not Site of replication (nucleus or cytoplasm) Site of replication (nucleus or cytoplasm) VPM 700 May’06

5. Families of RNA Viruses Arteriviridae: 13-15 kb (PRRS) Caliciviridae: 7.4-7.7 kb (Hepatitis E) Coronaviridae: 27-32 kb (SARS) Flaviviridae: 9.5-12.5 kb (West Nile) Picornaviridae: 7.2-8.4 kb (FMD) Rhabdoviridae: 11-15 kb (Rabies) Paramyxoviridae: 15-16 kb (Newcastle Disease) Birnaviridae: DS RNA: 6 kb (IBD) Reoviridae: DS RNA: 16-27 kb (Blue Tongue) Arenaviridae: ambisense: 10.6 kb (LCV) Bunyaviridae: 11-20 kb (Hanta) Orthomyxoviridae: 10-13.6 kb (Influenza) Non-segmented Segmented +ve sense -ve sense

6. Polarity Plus-stranded RNA viruses Plus-stranded RNA viruses - deproteinated genomes of these viruses are able to utilize the host cell machinery to initiate their life cycle Negative-stranded RNA viruses Negative-stranded RNA viruses - requires encapsidation with the viral nucleoprotein before it can serve as a functional template to initiate transcription/replication VPM 700 May’06

7. Schematic Diagram of RG Systems In vitro transcribed RNA Purified NP and P proteins vRNA RNP complex mRNA Infectious Virus Amp r P T pHH21 Pol I Amp r P T pCR3.1 CMV pA Transcription plasmid Expression plasmids for NP and Ps + OR VPM 700 May’06

8. Construction of a full- length cDNA clone Long and tedious! Long and tedious! Require the presence of the entire viral sequence Require the presence of the entire viral sequence - published sequence - or sequencing new isolate cDNA synthesis cDNA synthesis - require thermostable and high fidelity reverse transcriptase and DNA polymerase - require systematic assembly of large RNA genome - difficult to produce in vitro transcripts devoid of vector derived sequences Cloning Cloning - instability of full-length cDNA clones in bacteria Sequence verification Sequence verification VPM 700 May’06

9. Plus-stranded RNA viruses Poliovirus infectious clone (1981) Poliovirus infectious clone (1981) - Racaneillo and Baltimore, Science 214:916 - cloned in bacterial plasmid pBR322 Coronavirus Coronavirus - Almazan et al., 2000 (PNAS, 97:5516) - Yount et al., 2000 (J Virol, 74:10600) - Thiel et al., 2001 (J Gen Virol, 82:1273) VPM 700 May’06

10. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome (Almazan et al. 2000) Cloning of the cDNAs into a BAC Cloning of the cDNAs into a BAC Nuclear expression of RNA Nuclear expression of RNA

11. Strategy of systematic assembly of large RNA and DNA genomes ( Yount et al. 2000) Simple and rapid approach Simple and rapid approach - Mutagenesis and systematic cloning systematic cloning - Adjoining cDNA subclones subclones - In vitro transcription - RNA transfection

12. A cDNA copy of the human coronavirus genome cloned in vaccinia virus (Thiel et al. 2001) In vitro DNA ligation In vitro DNA ligation Clone into vaccinia virus Clone into vaccinia virus In vitro transcription In vitro transcription RNA transfection RNA transfection Cytoplasmic expression Cytoplasmic expression

13. Negative-stranded RNA viruses Difficulties Difficulties - precise 5’ and 3’ ends are required for replication and packaging of the genomic RNA - the viral RNA polymerase is essential for transcribing both mRNA and complementary, positive-sense antigenomic template RNA - both genomic and antigenomic RNAs exist as viral ribonucleoprotein (RNP) complexes - both genomic and antigenomic RNAs exist as viral ribonucleoprotein (RNP) complexes In 1994 (Schnell et al., EMBO, 13:4195-4203) In 1994 (Schnell et al., EMBO, 13:4195-4203) - the rescue of the first NS RNA virus, rhabdovirus rabies virus, starting entirely from cDNA VPM 700 May’06

14. Rescue of non-segmented negative-stranded viruses T7 Polymerase Expression System - Vaccinia virus - or Cell lines Transctiption plasmid for genomic RNA Expression plasmids For NP, P, etc. Helper virus OR ++ Infectious virus VPM 700 May’06

15. Rescue of Influenza Virus Family : Orthomyxoviridae Family : Orthomyxoviridae Genera influenza A virus Genera influenza A virus influenza B virus influenza B virus influenza C virus influenza C virus thogotovirus thogotovirus Segmented RNA genome Segmented RNA genome Negative polarity Negative polarity Replicates in the nucleus of infected cells Replicates in the nucleus of infected cells Chang-Won Lee, 1996 VPM 700 May’06

16. Genomes RNA segments (bp) Protein (aa) 1. Polymerase (basic) 2 (2341) PB2 (759) 2. Polymerase (basic) 1 (2341) PB1 (757) 3. Polymerase (acidic) (2233) PA (716) 4. Hemagglutinin (1775) HA (565) 5. Nucleoprotein (1565) NP (498) 6. Neuraminidase (1413) NA (454) 7. Matrix (1027) M1 (252) M2 (97) 8. Nonstructural (890) NS2(NEP)(121) NS1 (230) Virion constituents Infected cells

17. Structure of influenza virus VPM 700 May’06

18.  Binding  Endocytosis  Conformation change of HA  Fusion  Uncoating  Replication  Glycosylation  Budding Life cycle VPM 700 May’06

19. Key to generation of influenza virus  vRNA encapsidated by NP must be transcribed into mRNA by the viral polymerase complex  The vRNP complex is the minimal functional unit VPM 700 May’06

20. Helper virus-based method VPM 700 May’06

21. RNA polymerase I A nucleolar enzyme, which transcribes ribosomal RNA A nucleolar enzyme, which transcribes ribosomal RNA - In growing cells, rRNA accounts for 80% of the total RNA A Replacement of the rDNA template with a cDNA encoding an influenza viral gene did not impair the precise initiation and termination of transcription (Neumann et al., 1994) A Replacement of the rDNA template with a cDNA encoding an influenza viral gene did not impair the precise initiation and termination of transcription (Neumann et al., 1994) Amp r P T pHH21 -235 -130 -40 +12 +30 +1 UCE Core T1 T2 Influenza viral cDNA Promoter Terminator VPM 700 May’06

22. Plasmid-Based Reverse Genetics 293T Neumann et al. PNAS 96:9345-9350, 1999

23. Hoffmann, 2000 Bidirectional pol I - pol II transcription system Hoffmann et al. PNAS, 97:6108-6113, 2000

24. PT PT PT PT PT PT PT PT PA PA PA PA PB2 PB1 PA HA NP NA M NS PB2 PB1 PA NP Transcription Plasmid Expression Plasmid Transfection Amplification Infectious virus TP TP TP TP TP TP TP TP PB2 PB1 PA HA NP NA M NS Bi-directional Pol I-Pol II Plasmid CMV 293T or Vero MDCK or MDBK VPM 700 May’06

25. Amp r P T pHH21 Amp r T P Bi-pCR3.1 CMV pA Generation of RNA polymerase I constructs AGTAGAA....TTTTGCT TCATCTT....AAAACGA CGTCTCNTATTAGTAGAA....TTTTGCTCCCNGAGACG GCAGAGNATAATCATCTT....AAAACGAGGGNCTCTGC GGGTTATTGGAGACGGTACCGTCTCCTCCCCCC CCCAATAACCTCTGCCATGGCAGAGGAGGGGGG GGGT TCCCCCC CCCAATAA GGG TATTAGTAGAA....TTTTGC TCATCTT....AAAACGAGGG GGGTTATTAGTAGAA…….TTTTGCTCCCCCC CCCAATAATCATCTT…….AAAACGAGGGGGG OR Influenza viral cDNA Viral RNA PCR BsmBI PT Influenza viral cDNA BsmBI RT-PCR VPM 700 May’06

26. Cell lines for transfection Species-specificity of the RNA polymerase I - Human RNA Pol I : 293T, Vero, Cos-1 - Murine RNA Pol I : BHK21 - Chicken RNA Pol I : CEFs, QT-6 Replication of avian influenza virus - MDCK > SJPL>…..Vero or 293T Transfection efficiency VPM 700 May’06

27. Tranfection Efficiency MDCKVero293T VPM 700 May’06

28. Amp r P T pHH21 Amp r Bi-pCR3.1 CMV pA OR ECE 293T Rescued Virus Transfection Amplification 2-3 days MDCK 4 or 9 Expression Plasmid + VPM 700 May’06

29. References Boyer and Haenni. 1994, Virology 198:415-426 Boyer and Haenni. 1994, Virology 198:415-426 Walpita and Flick. 2005, FEMS Microbiol Letters 244:9-18 Walpita and Flick. 2005, FEMS Microbiol Letters 244:9-18 Neumann and Kawaoka. 2001, Virology 287:243-250 Neumann and Kawaoka. 2001, Virology 287:243-250 VPM 700 May’06