1. Genomes

2. Definition An organism‘s complete set of DNA
Complete set of instructions for making an organism
master blueprints for all enzymes, cellular structures & activities
An organism‘s complete set of DNA
All the DNA contained in the cell of an organism
The collection of DNA that comprises an organism.
Total genetic information carried by a single set of chromosomes in a haploid nucleus

3. Genome sequencing chronology
Year
Organism
Significance
Genome size (bp)
Number of genes
1977
Bacteriophage fX174
First genome ever!
5,386 11
1981
Human mitochondria
First organelle
16,500 37
1995
Haemophilus influenzae Rd
First free-living organism
1,830,137
~3,500
1996
Saccharomyces cerevisiae
First eukaryote
12,086,000
~6,000

4. Genome sequencing chronology
Year
Organism
Significance
Genome size (bp)
Number of genes
1998
Caenorhab-ditis elegans
First multi-cellular organism
97,000,000
~19,000
1999
Human chromosome 22
First human chromosome
49,000,000
673
2000
Drosophila melanogaster
First insect
150,000,000
~14,000
Arabidopsis thaliana
First plant genome
~25,000

5. Viral genomes Small, infectious obligate intracellular parasites
depend on host cell for replication
Viral genomes: ssRNA, dsRNA, ssDNA, dsDNA, linear or circular
Viruses with RNA genomes:
Almost all plant viruses, some bacterial and animal viruses
Genomes are rather small (a few thousand nucleotides)
Viruses with DNA genomes (e.g. lambda = 48,502 bp):
Often a circular genome.
Replicative form of viral genomes
all ssRNA viruses produce dsRNA molecules
many linear DNA molecules become circular

9. Agrobacterium tumefaciens
Procaryotic genomes
Generally 1 circular chromosome (dsDNA)
Usually without introns
Relatively high gene density (~2500 genes per mm of E. coli DNA)
Often indigenous plasmids are present
Eschericia coli
Agrobacterium tumefaciens

10. E. coli It is a free living, gram negative bacterium
It is a normal resident of the large intestine in healthy people
It grows best with incubation at 37°C in a culture medium that approximates the nutrient available in the human digestive tract
It is a type of probiotic organism because it crowds out disease causing bacteria.
It also makes vitamin K which humans require to be healthy.
Some strains make people sick. The toxic strains are responsible for about half of all cases of traveler's diarrhea.

11. E. coli
It replicates once every 22 minutes, giving rise to 30 generations and more than 1 billion cells in 11 hours
Its growth falls into several distinct phases (lag, logaritmic, stationary and death)
The individual cells are invisible to the naked eye, after plating onto solid medium, each cell divides to form a visible colony of identical daughter cells in hours

12. E. coli
It provides a relatively simple and well understood genetic improvement in which to isolate foreign DNA
Its primary genetic complement is contained on a single chromosome which locations and sequences of a large number of its genes are known
The genetic code is nearly universal
Under the best circumstances, the uptake of a specific foreign gene is a relatively rare occurrence and is thus most easily accomplished in a large populations that are reproducing rapidly

13. Coli genome Single chromosome of approximately 5 million base pairs
4288 protein coding genes:
Average ORF 317 amino acids
Average gene size 1000 bp
Very compact: average distance between genes 118bp
Contour length of genome: 1.7 mm
It can accept foreign DNA derived from any organism
Some genes are arranged in the plasmid

14. Plasmids Extra chromosomal circular DNAs -lactamase ori
Found in bacteria, yeast and other fungi
Size varies form ~ 3,000 to 250,000 bp.
Replicate autonomously (origin of replication)
May contain resistance genes
May be transferred from one bacterium to another
May be transferred across kingdoms
Multipcopy plasmids (~ up to 400 plasmids/per cell)
Low copy plasmids (1 –2 copies per cell)
Plasmids may be incompatible with each other
used as vectors that could carry a foreign gene of interest
foreign gene

15. Agrobacterium tumefaciens
This material is lifted directly from The University of Edinbourgh’s website called The Microbial World

16. Agrobacterium tumefaciens
Agrobacterium tumefaciens is a Gram-negative soil phytopathogennon-sporing, motile, rod-shaped bacterium, closely related to Rhizobium which forms nitrogen-fixing nodules on clover and other leguminous plants.
Agrobacterium affect most dicotyledonous plants in nature, resulting in crown gall tumors at the soil-air junction upon tissue wounding
Agrobacterium has the broadest host range of any plant pathogenic bacterium

17. Agrobacterium tumefaciens
Most of the genes involved in crown gall disease are not borne on the chromosome of A. tumefaciens but on a large plasmid, termed the Ti (tumour-inducing) plasmid.
It is important to note that only a small part of the plasmid (the T-DNA) enters the plant; the rest of the plasmid remains in the bacterium to serve further roles. When integrated into the plant genome, the genes on the T-DNA code for:
production of cytokinins
production of indoleacetic acid
synthesis and release of novel plant metabolites - the opines and agrocinopines.

18. Agrobacteria that causes neoplastic diseases in plants
Agrobacterium rhizogenes (hairy root disease).
Agrobacterium rubi (cane gall disease)
Agrobacterium tumefaciens (crown gall disease)
Agrobacterium vitis (crown gall of grape)

19. What will Agrobacterium tumefaciens affect in plants?
Crown gall disease is not generally fatal, but it will reduce plant vigor and crop yield, and crown galls will attract other phytopathogens or pests.
In some cases, necrosis or apoptosis is observed after Agrobacterium infection.

20. The discovery of Agrobacterium
In 1897, Fridiano Cavara identified a flagellate, bacilloid bacterium as a casual agent of crown gall of grape.
This organism is Agrobacterium vitis, causing the growth of neoplastic tumors on the stem and crown of grapevines and inducing necrotic lesions on grape roots.

21. Historical discoveries about agrobacterium
Turn of 20th century – found causes crown gall disease
1940’s – crown gall tissue cultured due to hormone autotrophy
1970’s – pathogenicity transferred between bacteria via conjugation – evidence of plasmid involvement
1980’s T-DNA was first engineered to carry useful genes into plants using methods that ‘hijacked’ the natural process

22. Evidence for plasmid involvement in the virulence of agrobacterium
Relationship between virulence and specific plasmids in different agrobacterium strains
Loss of virulence with loss of plasmids when grown at high temp (plus restoration of virulence when same plasmids replaced)
Virulence transferred when plasmids transferred between virulent and non-virulent strains
Stable nature of hormone autotrophy in infected host plant tissues indicated that this was genetically determined and could result from genetic transfers between agrobacterium and its host
Fragments of agrobacterium plasmids (T-DNA) were found in the DNA of diseased tissues
Plants regenerated from diseased tissues were bred to produce offspring which inherited the T-DNA in a Mendelian manner.
This indicated that the T-DNA was integrated into nuclear DNA

23. Autoradiogram of a Southern blot of DNA extracted from cured crown gall cells probed with T-DNA showing the presence of T-DNA within the plant genome.
Lanes 1 & 2: T-DNA extracted from agrobacterium Ti plasmid
Lanes 3, 5 & 6: DNA extracted from gall cells
Lane 4: DNA from non-infected plant tissue

24. Lives in intercellular spaces of the plant

25. Steps of Agrobacterium-plant cell interaction
Cell-cell recognition
Signal transduction and transcriptional activation of vir genes
Conjugal DNA metabolism
Intercellular transport
Nuclear import
T-DNA integration

26. Agrobacterium tumefaciens
Encodes a large (~250kbp) plasmid called Tumor-inducing (Ti) plasmid)
Plasmid contains genes responsible for the disease
Portion of the Ti plasmid is transferred between bacterial cells and plant cells  T-DNA (Transfer DNA)
T-DNA integrates stably into plant genome
Single stranded T-DNA fragment is converted to dsDNA fragment by plant cell
Then integrated into plant genome
2 x 23bp direct repeats play an important role in the excision and integration process

27. Agrobacterium tumefaciens
What is naturally encoded in T-DNA?
Enzymes for auxin and cytokinin synthesis
Causing hormone imbalance  tumor formation/undifferentiated callus
Mutants in enzymes have been characterized
Opine synthesis genes (e.g. octopine or nopaline)
Carbon and nitrogen source for A. tumefaciens growth
Insertion genes
Virulence (vir) genes
Allow excision and integration into plant genome

28. Genetic structure of the Ti plasmid
Oncogenes TR TL
Aux
Cyt
Opines
So far 24 vir genes arranged into 8 operons have been discovered:
virA
virG both are regulatory genes
virD2 binds to the 5’ end of single-stranded (ss) DNA
virD1
virD3 both work in conjunction with virD2 to form a complex that produces single strand nicks in the DNA of the Ti plasmid
virC1 binds to the T-DNA enhancer sequence
virE2 binds to the ss DNA
virB operon possibly involved in transfer of T-DNA through membrane of the bacterium or host cell because it codes for membrane proteins.
virB11 codes for ATPase
virF involved in determining the host range of the agrobacterium.

29. transfer
Left Border and Right Border
(Tumor-inducing)

30. Ti plasmid of A. tumefaciens

31. Auxin, cytokinin, opine synthetic genes transferred to plant
Plant makes all 3 compounds
Auxins and cytokines cause gall formation
Opines provide unique carbon/nitrogen source only A. tumefaciens can use!

32. Saccharomyces cerevisiae
Nonpathogenic
Rapid growth (generation time ca. 80 min)
Dispersed cells
Ease of replica plating and mutant isolation
Can be grown on defined media giving the investigator complete control over environmental parameters
Well-defined genetic system
Highly versatile DNA transformation system

33. Saccharomyces cerevisiae
Strains have both a stable haploid and diploid state
Viable with a large number of markers
Recessive mutations are conveniently manifested in haploid strains and complementation tests can be carried out with diploid strains
The ease of gene disruptions and single step gene replacements offers an outstanding advantage for experimentation

34. Saccharomyces cerevisiae
Yeast genes can functionally be expressed when fused to the green fluorescent protein (GFP) thus allowing to localize gene products in the living cell by fluorescence microscopy
The yeast system has also proven an invaluable tool to clone and to maintain large segments of foreign DNA in yeast artificial chromosomes (YACs) being extremely useful for other genome projects and to search for protein-protein interactions using the two-hybrid approach
Transformation can be carried out directly with short single-stranded synthetic oligonucleotides, permitting the convenient productions of numerous altered forms of proteins

35. The yeast genome
S. cerevisiae contains a haploid set of 16 well-characterized chromosomes, ranging in size from 200 to 2,200 kb
Total sequence of chromosomal DNA is 12,8 Mb
6,183 ORFs over 100 amino acids long
First completely sequenced eukaryote genome
Very compact genome:
Short intergenic regions
Scarcity of introns
Lack of repetitive sequences
Strong evidence of duplication:
Chromosome segments
Single genes
Redundancy: non-essential genes provide selective advantage

36. Eucaryotic genomes Located on several chromosomes
Relatively low gene density (50 genes per mm of DNA in humans)
Carry organellar genome

37. Plant genomes Plant contains three genomes
Genetic information is divided in the chromosome.
The size of genomes is species dependent
The difference in the size of genome is mainly due to a different number of identical sequence of various size arranged in sequence
The gene for ribosomal RNAs occur as repetitive sequence and together with the genes for some transfer RNAs in several thousand of copies
Structural genes are present in only a few copies, sometimes just single copy. Structural genes encoding for structurally and functionally related proteins often form a gene family
The DNA in the genome is replicated during the interphase of mitosis

39. Arabidopsis thaliana A weed growing at the roadside of central Europe
It has only 2 x 5 chromosomes
It is just 70 Mbp
It has a life cycle of only 6 weeks
It contains 25,498 structural genes from 11,000 families
The structural genes are present in only few copies sometimes just one protein
Structural genes encoding for structurally and functionally related proteins often form a gene family

40. Peculiarities of plant genomes
Huge genomes reaching tens of billions of base pairs
Numerous polyploid forms
Abundant (up to 99%) non coding DNA which seriously hinders sequencing, gene mapping and design of gene
Poor morphological, genetics, and physical mapping of chromosomes
A large number of “small-chromosome” in which the chromosome length does not exceed 3 μm
The number of chromosomes and DNA content in many species is still unknown

41. Size of the genome in plants and human
Arabidopsis thaliana
Zea mays
Vicia faba
Human
Nucleus
70 Millions
3900 Millions
14500 Millions
2800 Millions
Plastid
0.156 Millions
0.136 Millions
0.120 Millions
Mitochondrion
0.370 Millions
.570 Millions
.290 Millions
.017 Millions

42. Organisation of the genome into chromosome
The nuclear genome is organized into chromosome
Chromosomes consist of essentially one long DNA helix wound around nucleosome
At metaphase, when the genome is relatively inactive, the chromosome are most condensed and therefore most easily observed cytologically, counted or separated
Chromosomes provide the means by which the plant genome constituents are replicated and segregated regularly in mitosis and meiosis
Large genome segments are defined by their conserved order of constituent genes

43. Genome composition Heterochromatin 2. Euchromatin a. Centromere
Darkly staining portions of chromosomes, believed due to high degree of coiling
Non-genic DNA
a. Centromere
~ “middle” of Chromosomes
spindle attachment sites
b. Telomeres
1. ends of chromosome
2. important for the stability of chromosomes tips.
2. Euchromatin
Lightly staining portion of chromosomes
It represents most of the genomes
It contains most of genes.

44. Ploidy and chromosome number
Organism
Ploidy
Chromosome number
Corn
Diploid (2X) 20
Tomato 24
Arabidopsis 10
Potato
Tetraploid (4X) 48
Wheat
Hexaploid (6X) 42

45. Organization of Plant Genome
Most plants contain quantities of DNA that greatly exceed their needs for coding and regulatory functions
Very small percentage of the genome may encode for genes involved in protein production
Low-copy-number DNA
Portion of genome which encodes for most of the transcribed genes (Protein coding genes)
Tandemly repeated DNA
1. Medium-copy-number DNA
DNA sequences that encode ribosomal RNA (Tandemly repeated expressed
DNA)
2. High-copy-number DNA
It is composed of highly repetitive sequences (Repetitious DNA)

46. Segment of DNA which can be transcribed and translated to amino acid
Protein Coding Genes
Segment of DNA which can be transcribed and translated to amino acid 40

47. Protein Coding Genes Transcribed region ≈ Open Reading Frame (ORF)
long (usually >100 aa)
“known” proteins  likely
Basal signals
Transcription, translation
Regulatory signals
Yeast, ~1% of genes have ORFs<100 aa

48. Protein Coding Genes House keeping gene:
Plant contains about – structural genes
They are present in only a few copies, sometimes just one (single copy gene)
They often form a gene family
The transcription of most structural genes is subject to very complex and specific regulation
The gene for enzymes of metabolism or protein biosynthesis which proceed in all cells are transcribed more often
Most of the genes are switched off and are activated only in certain organ and then often only in certain cells
Many genes are only switched on at specific times
Yeast, ~1% of genes have ORFs<100 aa
House keeping gene:
The genes which every cell needs for such basic functions independent of its specialization

49. Nonfunctional copies of genes
Pseudogenes
Nonfunctional copies of genes
Formed by duplication of ancestral gene, or reverse transcription (and integration)
Not expressed due to mutations that produce a stop codon (nonsense or frame-shift) or prevent mRNA processing, or due to lack of regulatory sequences

50. Tandemly Repeated DNA
A large number of identical repeated DNA sequences
It spread over the entirely chromosome
There is variation within species for the number of copies in allelic arrays
Variations in the lengths of tandemly repeat units have been used as a sources of molecular marker
It is divided into:
1. Tandemly repeated expressed DNA
2. Tandemly repeated non expressed DNA (Repetitious DNA)

51. Tandemly Repeated Expressed Genes
Genes which are duplicated and clustered at many location of the genome
Ribosomal 18S, 58S, 25S and 5S RNA genes are highly reiterated in clusters and form at sites called nucleolus organizers (NOR)
They are also observed for tDNA and histones

52. Tandemly Repeat non expressed DNA
Repetitive sequences which are unable to be expressed but found in huge amount in the genome
Simple-sequence DNA
Moderately repeated DNA (mobile DNA)

53. Simple Sequence DNA
Very sort sequences repeated many times in tandem in large clusters
It is also called as satellite DNA
It often lies in heterochromatin especially in centromeres and telomeres
It is divided into 2 groups:
Mini satellite : Variable number tandem repeat (VNTR)
Micro satellite : Simple sequence repeat (SSR)
It is used in DNA fingerprinting to identify individuals

54. Tandemly repeated DNA Microsatellite (SSR: Simple sequence repeat)
Unit size: at most 5 bp
ATATATATATATATATATATATAT
Minisatellite
Unit size: up to 25 bp
ATTGCTGTATTGCTGTATTGCTGT

55. Mobile DNA
Units of DNA which are predisposed to move to another location, sometimes involving replication of the unit, with the help of products of genes on the elements or on related element
Move within genomes
Most of moderately repeated DNA sequences found throughout higher eukaryotic genomes
Some encode enzymes that catalyze movement
2 types:
a. Transposon
b. Retrotransposon

56. Transposon DNA
Involves copying of mobile DNA element and insertion into new site in genome
Molecular parasite: “selfish DNA”
They probably have significant effect on evolution by facilitating gene duplication, which provides the fuel for evolution, and exon shuffling

57. Retrotransposon (retroelement)
Transposon like segment of DNA
Retroviruses lacking the sequence encoding the structural envelope protein
Major component of plant genome
Size ranges from 1 to 13 kb in length
Widely distributed over the chromosomes of many plant species gene
Retrovirus
A virus of higher organism whose genome is RNA, but which can insert a DNA copy its genome into host chromosome

58. Eukaryotic cells
Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.

59. Mitochondrial genome (mtDNA)
Number of mitochondria in plants can be between
One mitochondria consists of 1 – 100 genomes (multiple identical circular chromosomes).
They are one large and several smaller
Size ~ 200 kb to 2,500 kb in plants
Mt DNA is replicated before or during mitosis
Transcription of mtDNA yielded an mRNA which did not contain the correct information for the protein to be synthesized.
RNA editing is existed in plant mitochondria
Over 95% of mitochondrial proteins are encoded in the nuclear genome.
Often A+T rich genomes

60. Chloroplast genome (ctDNA)
Multiple circular molecules, similar to procaryotic cyanobacteria, although much smaller ( %of the size of nuclear genomes)
Cells contain many copies of plastids and each plastid contains many genome copies
Size ranges from 120 kb to 160 kb
Plastid genome has changed very little during evolution. Though two plants are very distantly related, their genomes are rather similar in gene composition and arrangement
Some of plastid genomes contain introns
Many chloroplast proteins are encoded in the nucleus (separate signal sequence)

61. DNA for chloroplast proteins can be come from the nucleus or chloroplast genome
Buchannan et al. Fig. 4.4