1. DNA Structure and Function Chapter 12

2. Discovery of DNA Nucleic Acids were discovered in 1869 by Friedrich Mieschner as a substance contained within nuclei 1929 Phoebus Levene discovered that DNA was a polymer of nucleotides During the ’30s & 40’s proteins rather than DNA was thought to hold genetic information

3. Griffith Discovers Transformation 1928 Attempting to develop a vaccine Isolated two strains of Streptococcus pneumoniae  Rough strain was harmless  Smooth strain was pathogenic

4. 1. Mice injected with live cells of harmless strain R. 2. Mice injected with live cells of killer strain S. 3. Mice injected with heat-killed S cells. 4. Mice injected with live R cells plus heat- killed S cells. Mice die. Live S cells in their blood. Mice live. No live R cells in their blood. Mice die. Live S cells in their blood. Mice live. No live S cells in their blood. Transformation

5. What happened in the fourth experiment? The harmless R cells had been transformed by material from the dead S cells Descendents of the transformed cells were also pathogenic Why?

6. Oswald & Avery What is the transforming material? Cell extracts treated with protein-digesting enzymes could still transform bacteria Cell extracts treated with DNA-digesting enzymes lost their transforming ability Concluded that DNA, not protein, transforms bacteria

7. Bacteriophages Viruses that infect bacteria Consist of protein and DNA Inject their hereditary material into bacteria cytoplasm bacterial cell wall plasma membrane Figure 13.4b Page 219

8. Hershey & Chase’s Experiments Created labeled bacteriophages  Radioactive sulfur – Labels Proteins  Radioactive phosphorus – Labels Nucleic Acids Allowed labeled viruses to infect bacteria Asked: Where are the radioactive labels after infection?

9. Hershey – Chase Experiment

10. What is DNA? DNA is a Nucleic Acid Polymer of Nucleotides Each nucleotide consists of  Deoxyribose (5-carbon sugar)  Phosphate group  A nitrogen-containing base Four bases  Adenine, Guanine, Thymine, Cytosine

11. Nucleotide Structure

12. Composition of DNA Chargaff showed:  Amount of adenine relative to guanine differs among species  Amount of adenine always equals amount of thymine and amount of guanine always equals amount of cytosine A=T and G=C

13. Rosalind Franklin’s Work Was an expert in X-ray crystallography Used this technique to examine DNA fibers Concluded that DNA was some sort of helix

14. Watson-Crick Model DNA consists of two nucleotide strands: Double Helix Strands run in opposite directions - Antiparallel Strands are held together by hydrogen bonds between bases A binds with T and C with G The sides of the ladder are a sugar-phosphate backbone, while the “rungs” of the ladder are the bases

15. DNA is antiparallel

16. The four bases of DNA are: Adenine (A) Guanine (G) Thymine (T) Cytosine (C) Adenine always hydrogen bonds with Thymine (A-T) Guanine always hydrogen bonds with Cytosine (G-C) These bonding patterns are called base pairings (bp) Base-pairing rule

17. The pattern of base pairing is the mechanism by which DNA holds information. Humans have a > 6 billion of these base pairings Less than 5% of our DNA actually forms genes There about 30,000 genes encoded in our DNA, nearly half of these genes either have yet to be discovered or their function is unknown DNA is written out like this: CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACC CTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAG AGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGG CCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGC TGGGATCCTGGA

18. DNA replication Before mitosis and meiosis, all of the DNA in the cell must be copied or replicated How does this happen?

19. How does DNA replicate? Possibilities:

20. DNA Replication The mechanism by which DNA is replicated is considered semi-conservative Semi-conservative replication: Half of the original parent DNA molecule is conserved in each of the daughter molecules. This allows for the parent DNA to serve as a template for generating the daughter DNA molecules Half of the replicated DNA strand is “old” and the other half is “new”

21. new old DNA Replication Semi- Conservative

22. Basepairing During Replication Each old strand serves as a template for the new complementary strand

23. Enzymes Required for Replication Helicase: “Melts” or opens up the double strand so that the DNA is single stranded DNA polymerase: multiple types, responsible for the actual synthesis of DNA Ligase: Joins together small newly synthesized pieces of DNA called Okazaki fragments Primase: Adds an RNA primer so that DNA synthesis can begin

24. DNA is synthesized 5’ to 3’ Energy for synthesis comes from the removal of the two phosphates of the in coming nucleotide DNA Replication

25. Since DNA is antiparallel, synthesis occurs in opposite directions One strand in continuously synthesized - leading strand (5’  3’) The other is synthesized in short discontinuous strands - lagging strand (3’  5’) Because of this DNA synthesis is called Semidiscontinuous

26. DNA Replication

28. DNA Replication: Fast & Accurate! It takes E. coli <1 hour to copy 5 million base pairs in its single chromosome & divide to form 2 identical daughter cells Human cell copies its 6 billion bases & divide into daughter cells in only few hours Remarkably accurate  only ~1 error per 100 million bases  ~30 errors per cell cycle

29. DNA Repair Mistakes can occur during replication DNA polymerase can read correct sequence from complementary strand and, together with DNA ligase, can repair mistakes in incorrect strand