1. 1 18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone By Pete Kahn Mentors: Lydie Herfort and Peter Zuber Peter Zuber http://www.mapwatch.com/news-blog/images/phytoplankton.jpg

2. 2 Significance of phytoplankton Major primary producers: Major primary producers: O 2 : 90% O 2 : 90% CO 2 =>C 3 : 50% CO 2 =>C 3 : 50% Most abundant eukaryotes: 10 2 to 10 4 cells/ mL Most abundant eukaryotes: 10 2 to 10 4 cells/ mL Base of aquatic food chain Base of aquatic food chain

3. 3 Interactions with other Domains Bacterioplankton Colonization : POC=>DOC “Competition” for NO 3 2- and NH 3 ? http://www.fossilmuseum.net/Tree_of_Life/Domains_Archaea_Bacteria/Domains_of_life.jpg Grossart, H. P., Czub, G. & Simon, M. (2006). Algae-bacteria interactions and their effects on aggregation and organic matter flux in the sea. Environmental Microbiology 8, 1074-1084. Grossart, H. P., Czub, G. & Simon, M. (2006). Algae-bacteria interactions and their effects on aggregation and organic matter flux in the sea. Environmental Microbiology 8, 1074-1084.

4. 4 Traditional Methods Microscopy Microscopy Flow Cytometry Flow Cytometry Pigment analysis: Pigment analysis: Chl a Chl a Photosynthesis: Photosynthesis: O 2 production O 2 production C 14 uptake C 14 uptake Flow cytometry Microscopy: Pediastrium Filtering for chlorophyll a http://www.keweenawalgae.mtu.edu/ALGAL_IMAGES/ chlorophyceans/Pediastrium_n16_dollartow3_402_c.jpg http://upload.wikimedia.org/wikipedia/commons/c/c7/Pi coplancton_cytometrie.jpg

5. 5 Molecular Methods for eukaryotes Pitfalls of Traditional methods: -Microscopy: focus on numerous, “big” organisms; time consuming -Incomplete understanding of diversity Pitfalls of Traditional methods: -Microscopy: focus on numerous, “big” organisms; time consuming -Incomplete understanding of diversity Molecular Methods: nucleic acid extraction, PCR, cloning, sequencing Molecular Methods: nucleic acid extraction, PCR, cloning, sequencing Pitfalls of Molecular Methods: biases in PCR primers & preferential amplification of some organisms, i.e. dinoflagellates vs diatoms Pitfalls of Molecular Methods: biases in PCR primers & preferential amplification of some organisms, i.e. dinoflagellates vs diatoms Savin, M. C., Martin, J. L., LeGresley, M., Giewat, M. & Rooney-Varga, J. (2004). Plankton diversity in the Bay of Fundy as measured by morphological and molecular methods. Microbial Ecology 48, 51-65.

6. 6 Problems for phytoplankton Traditional methods studies >>>> molecular methods studies Traditional methods studies >>>> molecular methods studies Prokaryotic molecular studies >>>> phytoplankton molecular studies Prokaryotic molecular studies >>>> phytoplankton molecular studies

7. 7 18S rRNA clone library for: 18S rRNA clone library for: April: Wecoma & Forerunner: salinity gradient April: Wecoma & Forerunner: salinity gradient Wecoma (CR4s, CR15s, CR30s, CR40s): Wecoma (CR4s, CR15s, CR30s, CR40s): 20-32 psu; coastal surface samples 20-32 psu; coastal surface samples Forerunner (St 1-5): estuary samples Forerunner (St 1-5): estuary samples 0-20 psu, inc. of 5 0-20 psu, inc. of 5 June & July: Forerunner: 0 psu & 30 psu from estuary June & July: Forerunner: 0 psu & 30 psu from estuary The sampling plan

8. 8 Sample Dates & Locations Wecoma April 2007 Forerunner April 2007 Forerunner July 2007 Forerunner June 2007

9. 9 Goals within CMOP Short term: Short term: -Good clone library of phytoplankton -Good clone library of phytoplankton -Determining good primers for isolating 18S rRNA -Determining good primers for isolating 18S rRNA Long term: Long term: -Understand changes in populations between seasons and locations -Understand changes in populations between seasons and locations -Better understand unexpected changes in -Better understand unexpected changes in community: monitor ecosystem health community: monitor ecosystem health -Bacteria & Archaea relationships/ interactions (Dan Murphy) -Bacteria & Archaea relationships/ interactions (Dan Murphy) -Better understanding of microbial ecosystem as -Better understanding of microbial ecosystem as a whole a whole

10. 10 What we know about Columbia River phytoplankton Anderson GC. 1972. Aspects of marine phytoplankon studies near the Columbia River with special reference to subsurface chlorophyll maximum. The Columbia River estuary and adjacent ocean waters, University of Washington Press, Seattle, WA, p. 219-240. Anderson GC. 1972. Aspects of marine phytoplankon studies near the Columbia River with special reference to subsurface chlorophyll maximum. The Columbia River estuary and adjacent ocean waters, University of Washington Press, Seattle, WA, p. 219-240. Contaminant ecology of fish and wildlife of the lower columbia river-final report. April 1996. Lower Columbia River Bi-State Program. Contaminant ecology of fish and wildlife of the lower columbia river-final report. April 1996. Lower Columbia River Bi-State Program. Frey BE, R Lara-Lara, LF Small. 1984. Primary production in the Columbia River Estuary water column. Columbia River Estuary Data Development Program. Frey BE, R Lara-Lara, LF Small. 1984. Primary production in the Columbia River Estuary water column. Columbia River Estuary Data Development Program.

11. 11 What we know about Columbia River phytoplankton Estuary: >50 species of diatoms; Asterionella formosa; Asterionella kariana; Skeletonema Costatum; Thallasiosira; Stephanodiscus hatzschii Estuary: >50 species of diatoms; Asterionella formosa; Asterionella kariana; Skeletonema Costatum; Thallasiosira; Stephanodiscus hatzschii Coastal: Chaetoceros convolutus; Dactyliosolen mediterraneus; Thalassionema nitzschioides Coastal: Chaetoceros convolutus; Dactyliosolen mediterraneus; Thalassionema nitzschioides Asterionella formosa: most abundant diatom http://www.serc.si.edu/labs/phytoplankton/guide/diatoms/images/Asterionella/Asterionella-formosa-PA.jpg Thalassionema nitzschioides http://thalassa.gso.uri.edu/flora/imagesfl/tnema1.jpg

12. 12 DNA RNA Variations in nucleic acid in environmental samples Oct 2006 Between seasons Between locations April Wecoma & Forerunner: Freshwater << Surface Coastal Feb 2007

13. 13 Methods Overview Water sample => Sterivex on site Total nucleic acid extraction from sterivex in lab Amplification through PCR DNA removal? TOPO cloning/ transformation Plasmid isolation (Miniprep) 96 well plates? Sequences BLAST=> Clone library Water samples pass through sterivex filter

14. 14 Extraction/ DNA removal Extraction with LETS buffer + Phenol Chloroform Extraction with LETS buffer + Phenol Chloroform DNA removal with TURBO DNA free kit or Ribopure kit DNA removal with TURBO DNA free kit or Ribopure kit Sterivex Gel after extraction & DNA removal DNA removed DNA not removed

15. 15 PCR Primers: Euk A: AACCTGGTTGATCCTGCC Euk B: TGATCCTTCTGCAGGTTCACCTAC Specific for eukaryotes, Examined with BLAST: highly conserved Primers: Euk A: AACCTGGTTGATCCTGCC Euk B: TGATCCTTCTGCAGGTTCACCTAC Specific for eukaryotes, Examined with BLAST: highly conserved PCR cleanup with MO- BIO ultra clean kit PCR cleanup with MO- BIO ultra clean kit Gel after PCR Diez, B., Pedros-Alio, C. & Massana, R. (2001). Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Applied and Environmental Microbiology 67, 2932-2941.

16. 16 Cloning/ Transformation TOPO TA Cloning Kit TOPO TA Cloning Kit Transformation with Top 10 chemical competent cells => E. coli Transformation with Top 10 chemical competent cells => E. coli Plated onto LB XGAL-AMP plates Plated onto LB XGAL-AMP plates -Selective: cells gain ampicillin resistance from -Selective: cells gain ampicillin resistance from plasmid plasmid -Differential: cells w/plasmid insert turn white -Differential: cells w/plasmid insert turn white cells w/ no insert turn blue cells w/ no insert turn blue

17. 17 Plasmid isolation (miniprep) For 96 well plate, no miniprep. Send to Washington University For 96 well plate, no miniprep. Send to Washington University Recover plasmid from E. coli host Recover plasmid from E. coli host Clean plasmid and prepare to concentration of 100 ng/ ul Clean plasmid and prepare to concentration of 100 ng/ ul Take to primate center for sequencing Take to primate center for sequencing Gel from miniprep

18. 18 Sequences from April St 1 (0 psu): Rhizophydium St 1 (0 psu): Rhizophydium St 4 (15 psu): Pseudopedinella elastica; Protperidinium leonis; Katablepharis japonica St 4 (15 psu): Pseudopedinella elastica; Protperidinium leonis; Katablepharis japonica CR4s (27 psu): Asterionella kariana*; Thalassiosira aestivalis* Pirsonia guinardiae Gyrodinium rubrum CR 15s (20 psu): Thalassiosira pseudonana*: http://genome.jgi-psf.org/Thaps3/Thaps3.home.html http://www4.fimr.fi/project/algaline/GALLERY/0709NBP.JPG http://www.bsu.edu/classes/ruch/msa/barr/4-1.jpg Fungus Dinoflagellate Diatom: 1 st to have genome sequenced

19. 19 Sequences from Station 1 (0 psu) June Skeletonema costatum* Skeletonema costatum* -Diatom; extremely abundant in temperate areas -Diatom; extremely abundant in temperate areas Aulacoseira ambigua Aulacoseira ambigua -river diatom -river diatom Stephanodiscus hantzschii* Stephanodiscus hantzschii* -eutrophic freshwater diatom -eutrophic freshwater diatom Cyclotella meneghiniana Cyclotella meneghiniana -river diatom; areas of high conductivity -river diatom; areas of high conductivity http://thalassa.gso.uri.edu/ESphyto/list/taxa/skel/skelcos.htm http://craticula.ncl.ac.uk/EADiatomKey/html/taxon11.html http://www.lancs.ac.uk/staff/kingl/telford/stephhant.htm http://craticula.ncl.ac.uk/Eddi/jsp/taxon.jsp?TaxonId=AU002A

20. 20 Next step Use multiple primer sets to decrease PCR biases Use multiple primer sets to decrease PCR biases Traditional methods: Chl a analysis; Flow cytometry; Primary productivity rates Traditional methods: Chl a analysis; Flow cytometry; Primary productivity rates Apply protocol to ETM on future cruises Apply protocol to ETM on future cruises

21. 21 Acknowledgements Lydie and Peter Lydie and Peter Michiko Nakano Michiko Nakano Dan Murphy Dan Murphy Everyone in Peter & Michiko’s labs Everyone in Peter & Michiko’s labs Michael Wilkin & the crew of the Forerunner Michael Wilkin & the crew of the Forerunner Antonio Baptista Antonio Baptista NSF NSF All of you All of you