1. Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

2. Disruptive Innovations In Medicine Acute disease Chronic disease Mendelian diseasesComplex diseases “Average” medicine Personalized medicine

3. 500 400 300 200 100 505560657075808590 95 00 Deaths per 100,000 Year ~ 514,000 Actual Deaths in 2000 ~ 1,329,000 Projected Deaths in 2000  63% decrease in mortality  ~ 1 million early deaths averted per year  $2.6 trillion in economic return  New, effective treatments and prevention strategies Impact of Research on Heart Disease

4.  For the first time in recorded history, annual cancer deaths in the United States have fallen  10 million survivors Millions of People 1971 198619902003 9 6 3 Number of Survivors Impact of Research on Cancer

5. Impact of Research on Mental Illness  Diagnosis is by observation, detection is late, prediction is poor.  Etiology is unknown; prevention is empirical and not well-developed for most disorders.  Treatment is trial and error – no cures, no vaccines. Bottom line: Prevalence has not decreased for any illness. Mortality has not decreased for any illness.

6. Source: WHO World Health Report 2002 Burden of Disease (DALYs) U.S., Canada, and Western Europe 15-44 years old

7. Source: WHO World Health Report 2002 Burden of Disease by Specific Illness – DALYs United States, Canada, and Western Europe 15-44 years old

8. Mental Illnesses: Why the high morbidity? Prevalent (6% U.S. - serious) Disabling (largest population on SSI, SSDI) Chronic disorders of young people

9. Over 30,000 suicides per year (in the U.S.) - 90% related to mental illness Mental Disorders: Mortality For context: 18,000 homicides 20,000 AIDS deaths only 3 forms of cancer > 30,000

10. Public Health Impact: Early Mortality in Individuals with Major Mental Illness (MMI) Adapted from Colton and Manderscheid, 2006, Prev Chronic Dis Data from outpatient and inpatient clients diagnosed with MMI Average age at time of death : 56 years Increased likelihood of dying from suicide Decreased likelihood of dying from cancer

11. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

12. Affect in Subgenual Cingulate (BA25) Mayberg et al. Am J Psych 156:675-82 1999 increased CBF/Met’b decreased CBF/Met’b Depressed Affect R Cg25 Prefrontal 9 Cg25 Depression Recovery Cg25 Prefrontal 9

13. Non- Responders Fluoxetine Responders Is Cg25 change necessary for antidepressant efficacy? F9 Cg25 F9 hc Cg25 hc Cg25 pCg31 F9 p pCg31 Mayberg, 2006

15. oF11 pACC24 mF9/10 PCC MCC PF9/46 Par40 PM6 sACC25 hth bstem a-ins amg mb-vta hc na-vst thal Salience Motivation Mood state Self-awareness insight Cognition (attention-appraisal-action) Interoception (drive-autonomic-circadian) Defining Depression Circuits Response Pathways Br Med Bul 65:193-207, 2003 Arch Gen Psych 61:34-41-2004 CBT PF MF MCC Meds PF P Cg25 PCC BS MEDS

16. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

17. Source: J Giedd, NIMH Developmental Regression in the Brain

18. Schizophrenia as a Developmental Disorder

19. 10152025 Age # of Cortical Synapses Normal Development Based on McGlashan and Hoffman (2000) A Developmental Brain Model for Schizophrenia Psychosis Threshold Possible Paths to Schizophrenia Intervention

20. Genetic risk Unusual thought content Suspicion/paranoia Social impairment History of substance abuse 68-80% prediction Arch Gen Psych, 2008 Schizophrenia: A Developmental Brain Disorder

21. Progressive Brain Structural Changes Mapped as Psychosis Develops in “At Risk” Individuals Sun et al, Schiz Res., 2008

22. Schizophrenia Trajectory Stage 1: Presymptomatic, Risk factors, Cognitive deficit with challenge [< Age 15] Stage 2: Prodrome, cognitive deficits emerging, minor disability Stage 3: Psychosis, acute disability, family costs [Age 18 – 24] Stage 4: Chronic illness, medical complications, social costs [> Age 24] 1988 2008 2020 [Age 15 – 18]

23. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

25. The Genomics Revolution Human Genome Project (2003) Mapped 3 billion bases of DNA in human genome …CTAGGCTTAAGCGGACCTGCTCTAGGTCAGTC…. Human HapMap Project (2005) Mapped all the common variations in the human genome …CTAGGCTTAAGCGTACCTGCTCTAGCTCAGTC…. 3 million common Single Nucleotide Polymorphism (SNP) Structural Variations in the Genome (2007) …CTAGGCTTAGGCTTAGGCTTAGGCTTAAGCG GACCTGCTCTAGGTCAGTC….

26. 2005 20062007 first quarter 2007 second quarter 2007 third quarter 2007 fourth quarter First quarter 2008 Second quarter 2008 Manolio, Brooks, Collins, J Clin Invest 2008; 118:1590-625.

27. Autism Genes: What do we know from association studies? CNTNAP2 Neuroligins/Neurexins Shank3 Wnt2 GABA-B3 SLC25A12 (mit asp/glut carrier) MET (7q31) Phenotype?

28. Autism as a Synaptic Disorder AJHG 2008

29. Genomes Vary in Structure as well as Sequence From Scherer et al, Nature 2007

30. Pathways to Pathophysiology Meyer-Lindenberg & Weinberger, Nature Rev Neurosci, 2007

31. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

32. Current Treatments: How Good? CATIE (chronic schiz) STEP-BD (Bipolar) STAR*D (MDD) Real world setting Recovery of function Practical questions 10,000 patients, 200 sites, 3 diseases, practical trials

33. Schizophrenia: 74% discontinuation of anti- psychotics, limited access to psychosocial Rxs Depression: 31% remitted at 14 weeks, 67% at 1 year, limited access to CBT Bipolar: 21% stable for 8 weeks in first 6 months, high rates of medical co-morbidity Childhood disorders: dx prevalence increase 10- fold for autism, 40-fold for bipolar, no selective meds and few proven behavioral approaches Current Treatments: How Good?

34. Practical Trials – What Did We Learn? We can optimize care in real world settings With optimized care, outcomes are not optimal Current treatments help too few people get better and very few get well

35. NIMH Mission To transform the understanding and treatment of mental illnesses through basic and clinical research, paving the way for prevention, recovery, and cure.

36. NIMH Strategic Plan Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research

37. NIMH Strategic Plan Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders Genes to circuits to behavior cycle Genomics and epigenomics Developmental neuroscience

38. Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene NIMH Strategic Plan Predictive biosignatures Longitudinal designs Individual risk

39. NIMH Strategic Plan Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness Rational therapeutics Preemptive and personalized interventions Moderator trials

40. NIMH Strategic Plan Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research Participatory research Impact on practice Health disparities

41. NIMH Strategic Plan Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research

42. Yes, but this year the answers are completely different. But Professor Einstein, these are the same questions you used on last year’s exam?

43. www.nimh.nih.gov Paving the Way for Prevention, Recovery, and Cure

44. Then (1998) Mechanism: Chemical imbalance Treatment: First generation Diagnosis: Unitary Now (2008) Diagnosis: Categorical but co-morbid Mechanism: Brain circuit dysfunction Treatment: Second generation Imagine (2018) Diagnosis: Dimensional Mechanism: Genes to behavior Treatment: Personal & pre-emptive RESEARCH

45. PNAS, 2007 Mental disorders as brain disorders

46. Brain differences associated with depression Cg25 Area 25 – altered metabolism and 39% (bipolar) and 48% (unipolar) reduced grey matter volume Drevets et al., Nature, 1997

47. SSRI  Cg25 Placebo TMS ECT NoblerGeorgeMayberg Critical Role of Subcallosal Cingulate Cg25 SNRI Kennedy  Cg25 activity Mayberg Sad Memory Tryptophan Deplete SERT SS<LL MRI Depression:  Glia MaybergTalbot PezewasOngur Pre-CGT (FDG) Pre-DBS (CBF) Med NR (fMRI)  Cg25 activity DoughertyMayberg Greicius CBT/Med NR (FDG) Mayberg Bailey, Ballentine, Hunter-Brown, Laitenen Ablation Targets

48. Lancet Neurol 2007 Alzheimer’s: A Developmental Disorder?