1. Achim Tresch Computational Biology ‘Omics’ - Analysis of high dimensional Data

2. Slides: Doug Brutlag, Stanford University School of Medicine http://biochem158.stanford.edu/Epigenetics.html Epigenetics

3. C.H. Waddington coined the term epigenetics to mean above or in addition to genetics to explain differentiation. How do different adult stem cells know their fate? –Myoblasts can only form muscle cells –Keratinocytes only form skin cells –Hematopoetic cells only become blood cells –But all have identical DNA sequences. Epigenetics

4. Modern definition is non- sequence dependent inheritance. How can identical twins have different natural hair colors? How can a single individual have two different eye colors?

5. Mosaicism: One Eye, two Colors How can identical twin liter mates show different coat colors? How can just paternal or maternal traits be expressed in offspring? This is called genetic imprinting. How can females express only one X chromosome per cell? How can acquired traits be passed on to offspring?

6. Paula Vertino, Henry Stewart Talks The ‘epigenetic’ code DNA Methylation & Histone Modifications

7. Paula Vertino, Henry Stewart Talks Methylation of Cytosine in DNA cytosine5-methyl cytosine

8. Paula Vertino, Henry Stewart Talks Methylation of Cytosine in DNA

9. CpG dinucleotides are partially methylated in higher vertebrates Human genome: only ~4% of all cytosines are methylated, but ~ 70%-80% 5mCpG Spontaneous deamination transforms CpG to TpG or CpA Estimated rate (after DNA-repair) [1] : 5.8*10 -13 (5.8*10 -17 ) 1 / s*sites Wikipedia: Deamination, Thymine, 5-methylcytosine cytosine - uracil 5-methylcytosine - thymine [1] Shen et al. (1993) Nucl. Acids Res. DNA Methylation (Biochemistry)

10. Methylation of Cytosine in DNA

11. Me DNA methylation and Histones

12. Maintenance of Cytosine Methylation

14. Alex Meissner, Henry Stewart Talks Maintenance of Cytosine Methylation

16. Functions of cytosine methylation

17. Alex Meissner, Henry Stewart Talks DNA Methylation and Cell Differentiation

18. Alex Meissner, Henry Stewart Talks DNA Methylation and Cell Differentiation

19. Nuclear transplantation: Differentiated Cells can become Totipotent DNA Methylation and Cell Differentiation

20. Paula Vertino, Henry Stewart Talks Methylation Changes During Development Methylation level

21. Paula Vertino, Henry Stewart Talks Methylation Changes During Development Methylation level

22. Paula Vertino, Henry Stewart Talks Methylation Changes During Development Methylation level

23. © 2013 American Society of Plant Biologists TTCGCCGACTAATTCGCCGAuTAA DNA methylation– bisulfite sequencing Histone modification chromatin immunoprecipitation (ChIP) DNA Methylation and Histone Marks

24. GREEN = H3K27me3 PURPLE = methylcytosine Using next-generation sequencing, epigenetic modifications can be identified genome-wide: EPIGENOMICS and METHYLOMICS DNA Methylation and Histone Marks

25. http://www.39kf.com/uploadfiles/image/15902/TXT-20081228163836878.gif DNA methylation and Gene Expression

26. Methylation in mammals is mainly targeted at CpG dinucleotides CpGs are either unmethylated or methylated on both strands Hemi-methylated CpGs are rare DNA methyltransferases (DNMTs) bind hemi-methylated sites and modify the remaining position Thus the epigenetic information is inherited to daughter cells Adapted from: http://www.diagenode.com/en/applications/bisulfite-conversion.php Lars Feuerbach Epigenomics

27. © 2013 American Society of Plant Biologists Bisulfite treatment TTCGCCGACTAA No treatment TTCGCCGACTAA TTCGCCGAuTAA Methyl- cytosine When DNA is bisulfite treated, unmethylated cytosine is converted to uracil. Methylcytosine is not affected. O N NH 2 N ~ O N N ~ CH3 cytosine5-methylcytosine O N NH 2 N ~ CH3 O N O N ~ uracil5-methylcytosine Bisulfite treatment Bisulfite Sequencing

28. © 2013 American Society of Plant Biologists Bisulfite treatment TTCGCCGACTAA No treatment TTCGCCGACTAA TTCGCCGAuTAA TTCGCCGACTAATTCGCCGATTAA Methyl- cytosine After bisulfite treatment, unmethylated Cs are read as T and so differ in the treated and untreated samples. By contrast, methyl-C is read as C and is the same as the reference sequence. Bisulfite Sequencing

29. RRBS-Seq DNA is digested by MSP1 restriction enzyme which cuts at CCGG sites All DNA fragments start with CpG Alignment is simplified as reads have to map to MSP1 restriction sites Reads are enriched for CpG rich areas http://www.neb.com/nebecomm/products/productR0106asp CGGATGTTTTGTACTAGGATAAC TATGCCGGAT Reduced Representation Bisulfite Sequencing

30. Reference Read out Standard alignment to the reference is not possible. Adapted alignment procedures have lower accuracy. Alignment of BS converted reads

31. Tools supporting the alignment of BS reads: -Bismark -BSMAP -BS Seeker Simon Andrews, Bioinformatics 2011 Alignment of BS converted reads Key concept: -Convert the reference genome in silico as bilufite treatment does -Perform conversion for + strand and – strand -Then align reads against both genomes

32. Simon Andrews, Bioinformatics 2011 Alignment of BS converted reads H = IUPAC character for the letters {A,C,T}

33. Pearl-Necklace diagrams (lollipop plots) Measure unmethylated Cs (#C) Measure methylated Cs (#5mC) Report the methylation ratio Description of DNA methylation

34. © 2013 American Society of Plant Biologists Reprinted by permission from Macmillan Publishers Ltd: Zhong, S., Fei, Z., Chen, Y.R., Zheng, Y., Huang, M., Vrebalov, J., McQuinn, R., Gapper, N., Liu, B., Xiang, J., Shao, Y., and Giovannoni, J.J. (2013). Single-base resolution methylomes of tomato fruit development reveal epigenome modifications associated with ripening. Nat Biotechnol. [in press].in press Density of methylated DNA and other features in chromosomes of the tomato fruit The Tomato Methylome

36. Characterize deamination by repetitive sequences

37. Evolution of CpG content in repetitive sequences Peifer et al. (2008) Bioinformatics

38. Evolution of CpG-rich promoters AT-rich promoters in bacteria Mixed promoters in worm and fly Increasing GC and CpG content in mosquito Small CpG islands in fish Broad CpG islands in humans Khuu et al., PNAS, Sep. 2007

39. Promoter Types in Humans Weber et al., 2007, Nat. Genet.

40. Model of CpG island evolution

43. CpG island definitions CpG island definition: 1.GC-content 2.Ratio observed over expected CpG frequency 3.Minimal Length

44. CpG dinucleotides are rare in the human genome CpG Islands are exceptions Elevated GC content and CpG frequency 50-60% of promoters are CpG islands Methylation level anti-correlated to expression in HCP promoters Cause or consequence ? CpG islands

45. Caiafa and Zampieri,(2005) JCB CpG islands and chromatin

46. Histone modifications How to read the nomenclature: –Histone protein (H3) –Position in tail (K9) –Modification type (me3) Füllgrabe et al., 2011, Oncogene

47. Histone code Füllgrabe et al., 2011, Oncogene H3K4me2-me3Active transcription, near TSSs H3K9me3Heterochromatin H3K9acEuchromatin, near TSSs H3K27me3Polycomb marker, closes chromatin H4K16acHigher order chromatin, repeat methylation H4K20me3Heterochromatin

48. Interplay Ceder&Bergman,2009,Nature Rev Genet

49. Allele-unspecific DNA methylation

50. Allele-specific DNA methylation

51. Imprinting Origin-of-allele-specific gene expression Exception from Mendel’s inheritance rules Mediated by methylation of imprinting control regions University of Florida: http://www.peds.ufl.edu/divisions/genetics/teaching

52. Allele specific – Histone modifications Adapted from: http://genomebiology.com/content/figures/gb-2005-6-6-113-1-l.jpg

53. Reference Methylomes – Laurent et al. Laurent data on human embryonic stem cells and fibroblasts 70% of all CpGs covered by at least 3 reads Laurent et al. Genome Research 2010

54. Reference methylomes – Molaro et al. Male germline methylome for human and chimpanzee Direct comparison to Laurent et al. data Molaro et al. Cell 2011

55. ENCODE, IHEC and Epigenome Roadmap One Genome many Epigenomes Cataloguing epigenetic modifications in different tissues

56. Translation into NGS signals

57. Translation of epigenetic signals Capture-seq – Chromatin Immunoprecipitation (ChIP) – Metylated DNA Immunoprecipitation (MeDIP) – MBD chromatography Conversion-seq – Bisulfite sequencing (methyl-seq) – Reduced representation bisulfite sequencing (RRBS) – Ultra-deep amplicon sequencing

58. Two signal types Coverage Enrichment Sequencing Mapping Peak calling Sequence Preparation Sequencing Special mapping Decoding

59. Enrichment-seq – Workflow I Genome Epigenetically modified regions DNA Library Preparation

60. Enrichment-seq – Workflow II Enrichment

61. Enrichment-seq – Workflow III Mapping Genome

62. Enrichment-seq – Workflow IV Genome

63. Methylated DNA immunoprecipitation http://en.wikipedia.org/wiki/Methylated_DNA_immunoprecipitation

64. Lutsik P et al. Nucl. Acids Res. 2011;nar.gkr312 BiQ Analyzer HT

65. Allele-specific methylation analysis pipeline Matthias Bieg et al., in preparation

66. Summary Epigenetics plays a key role in cell function Each cell type has its own epigenome Epigenetic modifications are can be converted to NGS signals Bioinformatic in depth analysis of epigenomes is still in its infancy

67. References Laurent, L.; Wong, E.; Li, G.; Huynh, T. et al “Dynamic changes in the human methylome during differentiation” Genome Research (2010) 20 320-331 Molaro, A.; Hodges, E.; Fang, F.; Song, Q. et al. “Sperm Methylation Profiles Reveal Features of Epigenetic Inheritance and Evolution in Primates” Cell (2011) 146 1029-1041 Lutsik,P.; Feuerbach, L. ; Arand, J.; Lengauer, T. et al. “BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing” NAR (2011)

68. Environment can Influence Epigenetic Changes Emma Whitelaw, Henry Stewart Talks

69. Hongerwinter 1944 German’s blocked food to the Dutch in the winter of 1944. Calorie consumption dropped from 2,000 to 500 per day for 4.5 million. Children born or raised in this time were small, short in stature and had many diseases including, edema, anemia, diabetes and depression. The Dutch Famine Birth Cohort study showed that women living during this time had children 20-30 years later with the same problems despite being conceived and born during a normal dietary state.