1. Section H – Cloning vectors

2. Contents H1 Design of plasmid vectors H2 Bacteriophage vectors
Ligation products, Twin antibiotic resistance, Blue-white screening, Multiple cloning sites, Transcription of cloned inserts, Expression vectors
H2 Bacteriophage vectors
Bacteriophage λ, λReplacement vectors, Packaging and infection, Formation of plaques, λLysogens, M13 phage vectors, Cloning in M13, Hybrid plasmid-M13 vectors
H3 Cosmids, YACs and BACs
Cloning large DNA fragments, Cosmid vectors, YAC vectors, Selection in S. cerevisiae, BAC vectors
H4 Eukaryotic vectors
Cloning in eukaryotes, Transfection of eukaryotic cells, Shuttle vectors, Yeast episomal plasmids, Agrobacterium tumefaciens TI plasmid, Baculovirus, Mammalian viral vectors, Direst gene transfer

3. H1 Design of plasmid vectors — Ligation products
The most frequent unwanted product is recreated vector plasmid formed by circularization of the linear vector fragment

4. Minipreparations from a number of transformed colonies, and screening by digestion and agarose gel electrophoresis.

5. H1 Design of plasmid vectors — Twin antibiotic resistance
Contain two antibiotic resistance genes：
If a target DNA fragment is ligated into the coding region of one of the resistance genes the gene will become insertionally inactivated, and can be determined by the antibiotic resistance exhibited by the transformants.

7. B X B pBR322 B Ampr Tcr X ori Recombinant Religated
Screening by insertional inactivation of a resistance gene
B X B B X
Ampr
ori
Tcr
pBR322
Recombinant
Religated
Ampicillin resistant? yes yes
Tetracycline resistant? No yes

8. These colonies have bacteria with recombinant plasmid
Replica plating: transfer of the colonies from one plate to another using absorbent pad or velvet
transfer of colonies
+ampicillin
+ ampicillin
+ tetracycline
These colonies have bacteria with recombinant plasmid

9. H1 Design of plasmid vectors — Blue-white screening
A more sophisticated procedure can be carried out on a single transformation plate;
Blue white screening;
Involves the insertional inavtivation of the gene lacZ.

10. Lac promoter Ampr pUC18 lacZ’ (3 kb) ori
Screening by insertional inactivation of the lacZ gene
Lac promoter
MCS (Multiple cloning sites）
Ampr
pUC18
(3 kb)
lacZ’
ori
The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.

11. lacZ encode enzyme b-galactosidase
IPTG
X-gal
(substrate of the enzyme)
lac promoter
Blue product i
Operon
RegulatoryGene p o z y a
DNA
m-RNA
β -Galactosidase
Permease
Transacetylase
Protein

12. Recreated vector: blue transformants
Recombinant plasmid: white transformants (containing inserted DNA)
Recreated vector (no insert)
Recombinant plasmid (contain insert)

13. lacZ’: a shortened derivative of lacZ, encoding N-terminal a-peptide of b-galactosidase.
Host strain carrying a mutant gene encoding only the C-terminal portion of  -galactosidase which can then complement the a-peptide to produce the active enzyme

14. H1 Design of plasmid vectors — Multiple cloning sites
Multiple restriction sites enable the convenient insertion of target DNA into a vector
Ampr
ori
pUC18
(3 kb)
MCS
Lac promoter
lacZ’
…ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…
. Thr Asn Ser Ser Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser…
EcoRI
SacI
KpnI
SmaI
XmaI
BamHI
XbaI
SalI
HincII
AccI
PstI
SphI
Lac Z’
Insertion of target DNA in MCS inactivates the lacZ’

15. H1 Design of plasmid vectors — Transcription of cloned inserts
Some cloning vector ：The pUC vectors have a promoter (lac) adjacent to the site of insertion of a cloned fragment, such a promoter could be used to transcribe the inserted DNA, either to produce an RNA transcript in vitro (used as a hybridization probe), or to express the protein product of a gene.
Special transcriptional vectors
The pBluescript ⅡSK has promoters from bacteriophages T7 and SP6 flanking an MCS.

16. H1 Design of plasmid vectors — Expression vectors
(1)Promoter and terminator for RNA transcription are required.
(2)Intact ORF and ribosomal binding sites are required for translation.

17. Fusion protein and fusion tag
Strong Promoters
Promoter：
lacUV-5: a strong mutant lac promoter independent of cAMP receptor protein (CRP or CAP) .
lPL promoter
Phage T7 promoter
Fusion protein and fusion tag
Defined epitope : a small piece of peptide sequence containing a defined epitopeor specific binding site
Green fluorescent protein : fusion with GFP.
His-tag: usually 6 consecutive histidines, which allows purification of the fusion protein by binding to Ni 2+ column. Commonly used in E. coli.

18. pUC18 (3 kb) Ampr ori MCS Lac promoter lacZ’ EcoRI SacI KpnI SmaI XmaI
…ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…
. T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser…
EcoRI
SacI
KpnI
SmaI
XmaI
BamHI
XbaI
SalI
HincII
AccI
PstI
SphI
Lac Z’
The ORF of the inserted gene has to be in the same direction and same frame as the lacZ’
A fusion protein between the N-terminal sequence of lacZ and the inserted ORF produced

19. How to make a fusion protein (in pUC18)?
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
M I T N S S S V P G D P L E S T C R H A S L
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCgatgcggagc..gtgaacggatagCTGCAG
M I T N S S S V P G D P M R S ..V N G *
EcoRI
SacI
KpnI
SmaI
XmaI
BamHI
XbaI
SalI
HincII
AccI
PstI
SphI
HindⅢ
Add one nucleotide (g) between BamHI site (GGATCC) and the first codon (ATG) to fuse the two ORFs
BamHI: GGATCC PstI: CTGCAG
CCTAGG GACGTC
From original ORF
Inserted ORF
The following fusion is wrong:
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCatgcggagc..gtgaacggatagCTGCAG
M I T N S S S V P G D P C G G .. *

20. H2 Bacteriophage vectors — Bacteriophage λ
1.Viruses that can infect bacteria.
kb in length
3.Lytic phase： Replicate and release
4.Lysogenic phase ： integrate into host genome

21. （Linear or circular genome）
5.The phage  cos ends
（Linear or circular genome）
5‘-CGGGGCGGCGACCTCG-3’
3’-GCCCCGCCGCTGGAGC-5’
Cleavage Ligation
(during packaging) (after infection)
GGGCGGGCGACCTCG-3’
5’-CG GC-5’
3’-GCCCCGCCGCTGGA
Circular form
Linear form

23. H2 Bacteriophage vectors — λReplacement vectors
e.g. EMBL3, DASH
Replace the nonessential region of the phage genome with exogenous DNA (~20kb)

25. H2 Bacteriophage vectors — Packaging and infection
Replication of phage λin vivo produces long linear molecules with multiple copies of the λ genome. These concatemers are then cleaved at the cos sites, to yield individual λ genomes, which are then packaged into the phage particles.
Ligated λ ends which do not contain an insert, or have one which is smaller or larger than the 20kb optimum, are too small or to large to be packaged, and recombinants with two left or right arms are likewise not viable.
High infection efficiency (109 recombinants/ug vector DNA, 100-time higher than plasmid)

26. H2 Bacteriophage vectors — Formation of plaques
The clear areas within the lawn where lysis and re-infection have prevented the cells from growing.
Recombinant l DNA may be purified from phage particles from plaques or from liquid culture.

27. H2 Bacteriophage vectors — λLysogens
Genes or foreign sequences may be incorporated essentially permanently into the genome of E. coli by integration of a  vector containing the sequence of interest.

28. The E. coli strain BL21(DE3) include the gene for T7 RNA polymerase under control of the lac promoter as a  lysogen. The gene can be induced by IPTG, and the polymerase will then transcribe the gene in the expression vector.

29. H2 Bacteriophage vectors — M13 phage vectors
E. coli vector;
6.7 kb circular single strand of DNA;
Contrasting to phage ,the cell are not lysed by M13, but continue to grow slowly,and single-stranded forms are continuously packaged and released from the cells as new phage particles.

31. H2 Bacteriophage vectors — Cloning in M13
When the single-stranded form of a fragment is required fragments are subcloned into M13 RF using standard plasmid methods.
Cloning  Transfection  Growth  Plaques formation
RF recombinant plating on slow
like plasmid DNA a cell lawn growth

32. H2 Bacteriophage vectors — Hybrid plasmid-M13 vectors
Small plasmid vectors being developed to incorporate M13 functionality.
Contain both the plasmid and M13 origins of replication.
Normally propagate as true plasmids.
Can be induced to form single-stranded phage particles by infection of the host cell with a helper phage.

33. H3 Cosmids, YACs and BACs — Cloning large DNA fragments
Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage 
Human genome (3 x 109 bp): large genome and large gene demand vectors with a large size capacity.

34. The limitation of conventional gel electrophoresis: large DNA fragments do not separate, but instead, comigrate, because nucleic acids alternate between globular and linear forms.
If the field is applied discontinuously and the direction is also made to vary,the DNA molecules reorient their long axes and takes longer for larger molecules.

36. H3 Cosmids, YACs and BACs — Cosmid vectors
Utilizing the properties of the phage l cos sites in a plasmid vector.
The insert can be kb

37. The simplest cosmid vector
A normal small plasmid, containing a plasmid origin of replication, a selectable marker, a cos site, a suitable restriction site for cloning.

38. Cloning in a cosmid vector C2XB

39. H3 Cosmids, YACs and BACs — YAC vectors
Essential components of YAC vectors :
Centromere
Telomere
Autonomous replicating sequence
Ampr for selective amplification and markers

40. YACs can accommodate genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genes, but not good in mapping and analysis.
YACs have been invaluable in mapping the large-scale structure of large genomes, for example in the Human Genome Project.

43. H3 Cosmids, YACs and BACs — Selection in S. cerevisiae
(1)Growth of yeast on selective media lacking specific nutrients can serve for selection. Auxotrophic yeast mutants are made as host strains for plasmids containing the genes complementary to the growth defect.
(2)Saccharomyces cerevisiae selectable markers do not confer resistance to toxic substances

44. H3 Cosmids, YACs and BACs — BAC vectors
BAC: Bacterial Artificial Chromosome, 300kb
Vectors for large DNA fragments
BAC： 300kb
PAC: Bacteriophage P1 cloning system，100kb
Cosmid：35-45 kb
YAC: > 1Mb (1987)

45. H4 Eukaryotic vectors — Cloning in eukaryotes
Many applications of genetic engineering require vectors for the expression of genes in diverse eukaryotic species.

46. H4 Eukaryotic vectors — Transfection of eukaryotic cells
The take-up of DNA into eukaryotic cells
More problematic than bacterial transformation. The plant cell wall must normally be digested to yield fragile protoplasts, which may then take up DNA fairly readily.
Much lower efficiency

47. Transfection methods:
Calcium phosphate
Electroporation
Gene gun
Microinjection

48. H4 Eukaryotic vectors — Shuttle vectors
Most of the eukaryotic vectors are constructed as shuttle vectors .
Vectors contain sequences required for replication and selection in both E. coli and the desired host cells, so that the construction and many other manipulation of the vectors can be completed in E. coli., before transfer to the appropriate eukaryotic cells.

49. A Shuttle vector
MCS

50. H4 Eukaryotic vectors — Yeast episomal plasmids
Vectors for the cloning and expression of genes in Saccharomyces cerevisiae.
Based on 2 micron (2m) plasmid which is 6 kb in length.
One origin
Two genes involved in replication
A site-specific recombination protein FLP, homologous to  Int.
2. Normally replicate as plasmids, and may integrate into the yeast genome.

51. YEp vector

52. H4 Eukaryotic vectors — Agrobacterium tumefaciens Ti plasmid
1. Place the target gene in the T-DNA region of a Ti plasmid, then transform the recombinant Ti plasmid. (Not good because of the crown gall formation)
Deletion of the genes in T-DNA that are responsible for crown gall formation. The deleted T-DNA is called disarmed T-DNA shuttle vector.
2. The T-DNA and the remainder of the Ti plasmid are on separate molecules within the same bacterial cell, integration will still take place. Plasmid with recombinant T-DNA can be transformed into the A. tumefaciens cell carrying a modified Ti plasmid without T-DNA.

53. Agrobacterium mediated gene transfer
crown gall or tumor

54. Agrobacterium mediated gene transfer

55. H4 Eukaryotic vectors — Baculovirus
Infects insect cells
The strong promoter expressing polyhedrin protein can be used to over-express foreign genes engineered. Thus, large quantities of proteins can be produced in infected insect cells.
Insect expression system is an important eukaryotic expression system.

56. H4 Eukaryotic vectors — Mammalian viral vectors
1. SV40
5.2 kb, suffers from packaging constraints similar to phage l.
2. Retrovirus
Single-stranded RNA genome, which copy to dsDNA after infection. Integrated into the host genome by a transposition-like mechanism.
Have some strong promoters for gene expression. Considered as vectors for gene therapy

57. H4 Eukaryotic vectors — Direct gene transfer
Genes may be transiently or permanently introduced into cultured eukaryotic cells without the use of vector.

58. Multiple choice questions
1. Blue-white selection is used
A to test for the presence of a plasmid in bacteria.
B to reveal the identity of a cloned DNA fragment.
C to express the product of a cloned gene.
D to test for the presence of a cloned insert in a plasmid.
2. A multiple cloning site
A contains many copies of a cloned gene.
B allows flexibility in the choice of restriction enzymes for cloning.
C allows flexibility in the choice of organism for cloning.
D contains many copies of the same restriction enzyme site.

59. 3. Infection of E. coli by bacteriophage λis normally detected by .
A resistance of the bacteria to an antibiotic.
B the growth of single bacterial colonies on an agar plate.
C the appearance of areas of lysed bacteria on an agar plate.
D restriction digest of the bacterial DNA.
4. Which vector would be most appropriate for cloning a 150 kb fragment of DNA?
A a plasmid.
B a λvector.
C a BAC.
D a YAC.

60. 5. Which vector would you chose to express a foreign gene in a plant?
A a baculovirus vector.
B a retroviral vector.
C a Yep vector.
D a T-DNA vector.

61. THANK YOU !