1. printed by www.postersession.com Investigation of Possible Second Promoter in Cd4 through Comparison of the Relative Abundance of Transcripts Colby Uptegraft and Sophia Sarafova Biology Department, Davidson College, Davidson, NC 28036 1 Siu, G (2002). Immunology. 14: 441-451. Cd4 Locus Background The lineage commitment of T cells as they develop from double-positive (DP) (CD4 + CD8 + ) to CD4 + single-positive (SP) thymocytes requires the maintenance of Cd4 gene expression. The mechanisms controlling CD4 expression have been determined to be primarily transcriptional, and the locus in mice (Mus musculus) has been characterized to include a silencer, promoter (P1), thymocyte enhancer (TE), distal enhancer (DE), and a proximal enhancer (PE). 1 The human Cd4 gene locus contains an additional promoter (P2), and this corresponding region in mice has yet to be fully investigated. A second promoter in mice would help explain the sustained CD4 signal throughout T cell maturation and the different surface CD4 protein levels between DP and SP cells. If P2 exists, then two transcripts will be present, and their relative steady-state amounts can be compared through quantitative RT-PCR in ex vivo derived and cultured cells. DEPEP1Ex1S Ex2 ATG Ex3Ex4Ex6Ex5Ex9Ex8Ex10Ex7TEP2 ??? Ex1 Ex2 ATG Ex3Ex4Ex5Ex6Ex7Ex8Ex9Ex10 Processed P1 mRNA Processed P2 mRNA? Ex2Ex3Ex4Ex5Ex6Ex7Ex8Ex9 Ex2 ATG Ex3Ex4Ex5Ex6Ex7Ex8Ex9Ex10 RNA Isolation RLM-11 AKR1G1 DP Cell Lines Thymus Cells Lymph Node Cells FACS Staining CD8α antibody Tagged with FITC CD4 antibody Tagged with PE For Cell Lines and Thymus: For Lymph Node: Dynal Bead CD4 SP Isolation PNA Panning PNA Beads Magnet CD4 SP in Supernatant DP bound to PNA Post Purification FACS Staining CD4 antibody Tagged with PE TCRβ antibody Tagged with FITC TRIzol® Reverse Transcription and qPCR LN CD4 SP RNA THY DP RNA RLM-11 RNAAKR1G1 RNA DNase Treatment and RNA Cleanup Reverse Transcription (cDNA Synthesis) AAAAA TTTTT Oligo dT primers bind to Poly A tails of mRNA. AAAAA GGG RNase Treatment, PCR, and qPCR DNase treatment followed by Qiagen’s RNA cleanup kit removes contamination. With the same reverse primer, two unique forward primers and DNA polymerase amplify regions unique to P1 and P2 cDNA. SYBR green, a strong fluorescent intercalating agent, detects dsDNA and allows for the relative quantization of initial transcript levels in qPCR. P1 P2 RV P1 P2 RV Primer Design SYBR Green qPCR Detector Ex1 Ex2 ATG Ex3Ex4Ex5Ex6Ex7Ex8Ex9Ex10 P1 cDNA P2 cDNA Ex2Ex3Ex4Ex5Ex6Ex7Ex8Ex9 Ex2 ATG Ex3Ex4Ex5Ex6Ex7Ex8Ex9Ex10 Exon 1 Exon 2 Intron 1 between P2 and Ex2 Reverse Primer P1 Forward Primer P2 Forward Primer 5’ CTG TGA AGG CAA AGC AAG ACT CTC 3’ Exon 3 5’ TCC CTT GAG TGA CAG CTA GGA GTT 3’ 5’ TCT TAG TTT GGC AGG ACC TTT GGG 3’ Exon 3 5’ TCC CTT GAG TGA CAG CTA GGA GTT 3’ Expected P1-RV Amplicon Length: 231 bp Expected P2-RV Amplicon Length: 303 bp Figure 1 A B 1 2 3 4 5 6 7 8 9 1) 100 bp Ladder 2) LN P1 & RV 3) LN P2 & RV 4) THY P1 & RV 5) THY P2 & RV 6) gDNA P2 & RV 7) LN No RT 8) THY No RT 9) NTC 1) 100 bp Ladder 2) RLM-11 P1 & RV 3) RLM-11 P2 & RV 4) RLM-11 GADPH 5) RLM-11 No RT 6) AKR1G1 P1 & RV 7) AKR1G1 P2 & RV 8) AKR1G1 GADPH 9) AKR1G1 No RT References Future Directions B A C CTGTGAAGGCAAAGCAAGACTCTCTTCTTCACTAGGTACCTGTTTGCAAAGTCTCGAGCCCTCATATACACACACCTG TGCAAGAAGCAGAGTGAAGGAAGGACTGGCCAGAGGCTCAGATTCCCAACCAACAAGAGCTCAAGGAGACCACCATG TGCAAGAAGCAGAGTGAAGGAAGGACTGGCCAGAGGCTCAGATTCCCAACCAACAAGAGCTCAAGGAGACCACCGTG TGCCGAGCCATCTCTCTTAGGCGCTTGCTGCTGCTGCTGCTGCAGCTGTCACAACTCCTAGCTGTCACTCAAGGGA RLM-11 P1 & RV RLM-11 P2 & RV Expected Actual TCTTAGTTTGGCAGGACCTTTGGGGTGCATTACTGCAGGGTGCCCACTTTTGTGTATGCAGATAATGTT CTCTGGGTTGGTTATCAAGGTCCTGAGGAAGAGAAAGAGTTCTTGTGTGCCCCAGGCCCAAGGAATAC CTGAAGACTGATGATTTCTATCTTCCTCCGCCCCTGACATTTTTGTAGGCTCAGATTCCCAACCAACAA GAGCTCAAGGAGACCACCATGTGCCGAGCCATCTCTCTTAGGCGCTTGCTGCTGCTGCTGCTGCAGCT GTCACAACTCCTAGCTGTCACTCAAGGGA Devise more efficient method for purification of LN SP and THY DP cells. Redesign P2 and RV primer pair to span larger intron gap or find better way to eliminate the gDNA contamination problem. CD8 (FITC) 90.73 % 5.07% TCRβ (FITC) CD8 (FITC) CD4 (PE) 93.93 % 2.71 % CD4 (PE) TCRβ (FITC) 40.68 % 97.75 % CD4 (PE) CD8 (FITC) 97.98 % CD8 (FITC) CD4 (PE) 97.20 % Figure 2 Cd4 Transcript Levels Relative to GADPH Two unique transcripts of the expected lengths were present in both B10.A LN SP and purified B6 THY DP cells. gDNA contamination in cDNA from both types of cells prevented qPCR analysis of the P2 transcript. Two unique transcripts of the expected lengths were present in both DP thymoma cell lines as well, and GADPH primers yielded a product of the expected size. No gDNA contamination for either primer pair allowed for an accurate qPCR analysis. Sequencing of the qPCR products from the RLM-11 cell line confirmed amplification of the correct targets. DP thymoma cell lines showed similar amplification patterns for GADPH, P1, and P2 cDNA. GADPH cDNA is detected around cycle 20 while P1 and P2 cDNA are detected around cycles 25 and 30 respectively. A significantly greater relative amount of the steady-state P1 as compared to the P2 transcript was present in both cell lines, suggesting P1 is the main promoter at the DP stage (P1:P2 ≈ 44 in RLM-11 and 67 in AKR1G1). The relative steady-state amount of P1 in B10.A LN SP cells was 2.25 times greater than the amount in purified DP THY cells. Which transcript is the predominant one remains to be determined. Acknowledgements We would like to thank Chris Van Rooyen for the maintenance of our lab equipment, Amy Becton for the upkeep of our mice, Maria Cowen and Kay Filar for handling our many orders, Dr. Campbell’s lab for coping with our countless intrusions.