1. (B) HDR assay (6nt) (D) HDR assay (1nt)
(A) Creation of disrupted EmGFP mutant (6nt) (C) Conversion of eBFP to GFP (1nt)
Wild type …GTG ACC ACC TTC ACC TAC GGC…
Val Thr Thr Phe Thr Tyr Gly
Mutant …GTG ACC ACC TAC GGC…
Val Thr Thr Tyr Gly
Residue
(B) HDR assay (6nt) (D) HDR assay (1nt)
Supplementary Figure S1. Homologous recombination assays.
GFP
Phase
contrast
Cas9 RNP Cas9/donor Cas9 RNP/donor
eBFP …CTG ACC CAC GGC…
Residue
Leu Thr His Gly
GFP …CTG ACC TAC GGC…
Leu Thr Tyr Gly
eBFP
Cas9 RNP Cas9/donor Cas9 RNP/donor

2. Supplementary Figure S1. Generation of stable cell lines for HDR assays.
(A) A disrupted EmGFP HEK293 stable cell line containing deletion of “CACCTT” was generated by transfecting cells with Cas9 RNPs, followed by limiting dilution and clonal isolation. (B) HDR assays were carried out by transfecting disrupted EmGFP HEK293 cells with Cas9 RNP and donor DNA, followed by flow cytometric analysis at 48 hours post transfection. Transfections without either donor DNA (Cas9 RNP) or gRNA (Cas9/donor) were used as controls. (C) A stable HEK293FT cell expressing eBFP gene was generated using Lentiviral delivery system. A point mutation from “C” to “T” would convert His66 to Tyr66, resulting in generation of a variant of GFP. (D) HDR assays were performed by transfecting eBFP-expressing HEK293 cells with Cas9 RNP and donor DNA, followed by flow cytometric analysis to determine the percentage of GFP-positive cells at 48 hours post transfection. Transfections without either donor DNA (Cas9 RNP) or gRNA (Cas9/donor) served as controls.

3. Supplementary Figure S2. Optimization of delivery of Cas9 RNP in HEK293
Protocol
Pst 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Pulse Voltage
1150
1400
1500
1600
1700
1100
1200
1300
1000
850
950
1050
Pulse Width 30 40
# of Pulse 1
A master mix of Cas9 RNPs were prepared and electroporated into HEK293 cells using the Neon® 24-well
optimization protocol. The % Indel was determined at 48 hours post transfection

4. and ssDNA oligonucleotide
Supplementary Figure S3. Optimization of sequential delivery of Cas9 RNPs
and ssDNA oligonucleotide
147-fold induction
126-fold induction
Electroporation Protocol
Non-PAM PAM Non-PAM or PAM strands
µg of ss Oligonucleotide
Cas9 RNPs were delivered into HEK293 cells and then washed once with Resuspension Buffer R. The cell pellets were resuspended in Buffer R and supplemented with ssDNA oligonucleotide, followed by electroporation using the Neon® 24-well optimization protocol. The percentages of EmGFP-positive cells were determined by flow cytometry. Cas9 RNPs (cas9 nuclease and gRNA) and Cas9/D (Cas9 nuclease and donor without gRNA) served as controls.

5. Supplementary Figure S4
Supplementary Figure S4. Optimization of sequential delivery of Cas9 RNPs
and dsDNA Fragment
Cas9 RNPs were delivered into HEK293 cells and then washed once with Resuspension Buffer R. The cell pellets were resuspended in Buffer R and supplemented with dsDNA DNA fragment, followed by electroporation using the the Neon® 24-well optimization protocol. The percentages of EmGFP-positive cells were determined by flow cytometry. Cas9 RNPs (cas9 nuclease and gRNA) and Cas9/D (Cas9 nuclease and donor without gRNA) served as controls.

6. Supplementary Figure S5
Supplementary Figure S5. Both asymmetric PAM and non-PAM ssDNA donors facilitate HDR
(A) Cleavage sites
(B) Asymmetric donors for +3
(C) HDR efficiency at +3
non-PAM30-67 3’ 5’
Insertion 3’ 5’
non-PAM50-48 3’
non-PAM67-30 +3 5’ 5’ 3’
PAM67-30 5’ 3’ 5’ 3’
PAM48-50 3’ 5’ 5’ 3’
PAM30-67 -3 +5 3’ 5’
non-PAM30-51
PAM strand is defined as
the NGG-containing strand
For +3: top strand
For -3, +5 : bottom strand 3’ 5’
non-PAM40-40 3’ 5’
non-PAM51-30 5’ 3’
PAM51-30 5’ 3’
PAM40-40 5’ 3’
PAM30-51
(D) Asymmetric donors for -3/+5
(E) HDR efficiency at (F) HDR efficiency at +5 3’ 5’
non-PAM30-67 3’ 5’
non-PAM50-48 3’ 5’
non-PAM67-30 5’ 3’
PAM67-30 5’ 3’
PAM48-50 5’ 3’
PAM30-67 3’ 5’
non-PAM30-51 3’ 5’
non-PAM40-40 3’ 5’
non-PAM51-30 5’ 3’
PAM51-30 5’ 3’
PAM40-40 5’ 3’
PAM30-51

7. Supplementary Figure S5
Supplementary Figure S5. Both asymmetric PAM and non-PAM ssDNA donors facilitate HDR
(A) Three separate gRNAs flanking the insertion site (, 0) were designed and synthesized with double-stranded breaks (DSB) occurred at position -3, +3 and +5 separately. PAM strand is defined as the NGG-containing strand. The +3 gRNA’s PAM is on the top 5’ to 3’ strand (▼), whereas the -3 and +5 gRNAs have PAMS on the bottom 3’ to 5’ strand (▲). (B,D) A series of ssDNA donors were designed with various number of nucleotides on the left arm (-) and right arm (+) of the insertion site. Both the PAM and non-PAM strands were used. (C) The Cas9 RNP (1.5 ug Cas9 nuclease, 360 ng of the +3 gRNA) and ssDNA donors (10 pmol) were sequentially delivered to disrupted EmGFP stable HEK293 cell lines. At 48 hours post transfection, the % Indel was determined by the Genomic Cleavage and Detection assay (Figure 3B), whereas the percentages of EmGFP-positive cells were determined by flow cytometry. (E,F) Same as (C) except that the -3 gRNA or +5 gRNA was used.

8. (A) Asymmetric PAM or Non-PAM strand ssDNA annealing
Supplementary Figure S6. Both asymmetric PAM and non-PAM ssDNA donor facilitate HDR
(A) Asymmetric PAM or Non-PAM strand ssDNA annealing
Base substitution
PAM65-35 +1
65nt
35nt
PAM 3’
DSB
ssDNA
PAM 3’ 5’ or
PAM 5’
Non-PAM
Non-PAM
Non-PAM 3’ 5’
35nt
65nt 5’ 3’
Resection
annealing
Non-PAM65-35
PAM ssDNA is defined as the PAM-containing strand
(a)
(b)
(B) Asymmetric donor design (C) HDR efficiencies
Base substitution +1 5’ 3’
PAM 3’ 5’
Non-PAM 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ 5’ 3’ 3’ 5’

9. Supplementary Figure S6
Supplementary Figure S6. Both asymmetric PAM and non-PAM ssDNA donor facilitate HDR
A series of ssDNA donors were designed with various number of nucleotides on the left arm (-) and right arm (+) of the insertion site (). The PAM ssDNA oligonucleotide is defined as the NGG PAM containing strand. Both the PAM and non-PAM strands were tested. The Cas9 RNP (1.5 ug Cas9 nuclease, 360 ng eBFP gRNA) and ssDNA donors (10 pmoles) were sequentially delivered into an eBFP stable HEK293 cell line. At 48 hours post transfection, the percentages of EmGFP-positive cells were determined by flow cytometry. The bar graphs represented the averages of three individual experiments.

10. Supplementary Figure S7.
(A) Asymmetric donor design (B) HDR efficiencies
(insertion) 3’ 5’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ 5’ 3’
% GFP cells
Efficiency of symmetric and asymmetric oligos for in vivo SNP correction. (A) Illustration showing gRNA sequence targetting eBFP and various asymmetric oligos containing SNP.
(B) Flow cytometer analysis of cells expressing eGFP 72 hrs post transfection. 293FT-eBFP cell line transfected with gRNA and Cas9 mRNA targeting eBFP and various 100 bp symmetric and asymmetric oligos containing SNP.
Method: 293FT-eBFP cell line was used for SNP correction. 150K cells plated in a single well of 24 well tissue culture plate. For HR experiment, 10 pico moles of oligo along with 150ng gRNA and 500 ng Cas9 mRNA/well were used. Transfection was performed using Lipofectamine™ messengerMAX micro liter of transfection reagent was used in a single well of 24 well.

11. Supplemental Figure S8 A) B)
An aliquot of 1 x 105 Cas9-stable iPSCs in 5 µl of Resuspension Buffer R were mixed with approximately 7 µl of Resuspension Buffer R containing 500 ng beta-actin gRNA and 10 pmoles of ssDNA donor. Cell suspension without gRNA or ssDNA donor served as controls. 10 µl of sample mixture was used for electroporation with voltage set at 1300v, pulse width set at 10 ms, and the number of pulses set at 3, respectively (Program #21). The electroporated iPSCs were transferred to a 48-well plate coated with Geltrex and filled with 0.5 ml conditioned media containing 4 ng/ml bFGF and 5 µM ROCK inhibitor Y At 48 hours post transfection, cells were washed with DPBS and then lysed in 15 µl of lysis buffer. The genomic loci were amplified using the corresponding PCR primers, followed by genomic cleavage and detection assay (A). Alternatively, the resulting PCR products were then subjected to HindIII digestion. The percentage of digestion was quantified (B).

12. (A) Donor configuration (B) HDR efficiency determined by sequencing
Supplementary Figure S9. Insertion of a FLAG tag along with a restriction site
into a genomic locus
(A) Donor configuration
(B) HDR efficiency determined by sequencing
30nt
FLAG+EcoRI 5’ 3’
ssDNA
32nt
32nt 3’
32-3’ 3’ 5’
32nt
32-5’
32nt 5’ 5’ 3’ 3’
GGN 5’
The +5 gRNA targeting the EmGFP gene was used to target the bottom 3’ to 5’ strand (▲). The resulting Cas9 RNPs and ssDNA donor
or short dsDNA donors with either 5’ or 3’ single stranded overhangs were delivered to cells via sequential electroporation. The
insertion efficiency of a FLAG tag was determined by EcoRI digestion and sequencing. Samples in the absence of gRNA served as controls.

13. Supplemental Figure S10
(A) HDR efficiency in iPSC at HPRT (C) HDR efficiencies in Cas9 stable iPSC
+gRNA -gRNA P P21
HPRT USP CREBBP MDC1
(B) Mutation Pattern
WT :GCATTTCTCAGTCCTAAA-CAGGGTAATGGACTGGGGCTG
Clone 1:GCATTTCTCAGTCCTACA-CAGGGTAATGGACTGGGGCTG
Clone 4:GCATTTCTCAGTCCTAAA GGACTGGGGCTG
Clone 5:GCATTTCTCAGTCCT GGACTGGGGCTG
Clone 6:GCATTTCTCAGTCCTAAAACAGGGTAATGGACTGGGGCTG
Correct HDR
NHEJ

14. Supplementary Figure S10. Precise genome editing in iPSC
Supplementary Figure S10. Precise genome editing in iPSC. (A) Cas9 RNP and a non-PAM ssDNA oligonucleotide targeting HPRT were co-delivered into iPSC via electroporation using Program 7 (1200V; 30ms;1pulse) (P7) or Program 21 (1300V; 10ms; 3pulses) (P21). Samples in the absence of donor (+gRNA) or gRNA (-gRNA) served as controls. At 48 hours post transfection, the genomic locus of HPRT was PCR-amplified. The resulting PCR fragments were subjected to either the Genomic Cleavage and Detection assay or sequencing of 96 samples. The relative percentage of wild type (wt), NHEJ, and HDR was plotted (A) based on three individual experiments. Examples of edited sequences were shown in (B) and (C). (D) Various gRNAs and ssDNA donors targeting HPRT, USP12, CREBBP, and MDC1 loci were co-delivered to stable iPSC line expressing Cas9 nuclease using Program 21. The delivery of gRNA alone or donor alone served as controls (data not shown). Upon 48 hours post transfection, the corresponding genomic loci were PCR-amplified. The resulting PCR fragments were analyzed by genomic cleavage and detection assays to determine the percentages of Indel or by sequencing to determine the relative percentage of wild type (wt), NHEJ, HDR clones.

15. Supplementary Figure S11. Western Blot analysis of isolated iPSC clones.
M Neg C1 C2
130 kd
M: marker
Neg: negative control
C1: clone1
C2: clone2

16. Time-lapse imaging for HR
Supplementary Video S1.
Time-lapse imaging for HR
293FT-BFP cells
CRISPR+ssDNA
Image taken every 2 hours
Image for 3 days
The Cas9 RNP (1.5 ug Cas9 nuclease, 360 ng eBFP gRNA) and ssDNA donors (10 pmoles) were transfected into an eBFP stable HEK293 cell line. The images were recorded every 2 hours for a total of 72 hours using an IncuCyte instrument.