1. BIOBASE Training TRANSFAC® ExPlain™
Containing data on eukaryotic transcription factors, their experimentally-proven binding sites, and regulated genes
ExPlain™
Combining promoter and pathway analysis to understand differential gene expression

2. Simplifies the vast biological literature space
Focuses on peer-reviewed scientific literature
Experimental results are extracted by highly trained scientific curators
Content is updated quarterly

3. Provides easy access to experimental data
Information extracted from the literature is organized using controlled vocabulary standards, therefore it is easily searchable
Species specific, detailed curation is organized into focused reports
Analysis tools provide opportunities to leverage known information for your research needs

4. TRANSFAC® and ExPlain™ advantages
View how transcription factors are known to regulate target genes
Perform prediction of transcription factor binding sites
Model how transcription factors act together to affect gene expression patterns
Understand the cause, not just the effect, of differential gene expression in response to drug treatment, disease state, environmental stimulus and more

5. More than 2,000,000 data points

6. TRANSFAC® – TF binding site prediction
HIF-1
Experimentally verified DNA binding sites from literature
Derived consensus site
in form of positional weight matrix (PWM)
Tools for binding site prediction on the basis of the PWMs

7. Matrix-based Binding Site Search
FP (frequency of matches in the background set )
FN (% of real sites that are not recognized )
10 %
score
minFN/FN10
minSUM
minFP

8. Match™ – Matrix-based TF binding site search
ttcttgaatgtaaacgtttaacaataaatcgcttgaat A 2 4 5 3 1 7 C 6 G T
score s1
Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut-off, the subsequence is included as a putative binding site in the Match result.

9. Match™ – Matrix-based TF binding site search
ttcttgaatgtaaacgtttaacaataaatcgcttgaat A 2 4 5 3 1 7 C 6 G T
score s2
Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut-off, the subsequence is included as a putative binding site in the Match result.

10. Match™ – Matrix-based TF binding site search
ttcttgaatgtaaacgtttaacaataaatcgcttgaat A 2 4 5 3 1 7 C 6 G T
score s3
Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut-off, the subsequence is included as a putative binding site in the Match result.

11. Matrices included within the last year, are based on the following types of experiments:
3D structure-based energy calculations
bacterial-one-hybrid system (B1H)
ChIP-on-chip
ChIP-Seq
compiled matrix imported from literature reference
compiled matrix imported from public database
direct gel shift
DNA-binding affinity assay
DNase I footprinting
matrix compiled from individual genomic sites
SELEX (CASTing, SAAB, TDA, Target detection assay)
universal protein binding microarrays (PBM)

12. Composite model analysis (CMA)
Find combinations of binding sites that are unique to a gene set
Looks for transcriptional co-regulation

13. ExPlain™ Analysis System
Content & Application: TRANSFAC® & ExPlainTM
ExPlain™ Analysis System
Integrated Network and Promoter Analysis
TRANSFAC®
Database on transcription factors, their experimentally verified binding sites, positional weight matrices, ...

14. ExPlain™: understanding differential gene expression
+ / - Drug treatment
Disease vs. normal
+ / - Environmental stimulus

15. Live demo TRANSFAC® Here are the details for the training server VM:
Host:
Credentials for Apache Basic Authentication:
Username: coh
Password: coh$bio
The three installed BKL builds all have users training01 - training40 (same password) set up already. I will use training01, you can use any of the remaining 39 users.