1. GeneXpert for Detection of MTB and Rifampin Resistance
David Warshauer, PhD, D(ABMM)
Deputy Director, Communicable Diseases
Wisconsin State Laboratory of Hygiene

2. HEALTHY
PEOPLE
2010
2020
In January of 2000, “Healthy People 2010” was published. This document presented a set of health goals and objectives for the Nation to achieve over the first decade of the 21st century.. It provides 467 health improvement objectives and 434 subobjectives. including several objectives related to tuberculosis. Well, 2010 has come and almost gone, and we now have “Healthy People So, did we accomplish the goals for tuberculosis that were proposed in “Healthy People 2010” ?
Well, let’s go to slide 6.

3. Reduce TAT for laboratory Dx Target: 2 days for 75% [21 days // ’96]
14-14
Reduce TAT for laboratory Dx
Target: 2 days for 75%
[21 days // ’96]
U.S. Department of Health and Human Services, January 2000
This slide shows the 2010 objective that addressed the laboratory diagnosis of TB. The objective was to attain a TAT of 2 days for 75% of the TB cases in the United States. A survey in 1996 showed that the average time to the laboratory diagnosis of TB was 21 days. A 2 day TAT was not achieved by 2010, although I think there has been an improvement over the years.

4. Percentage of Culture-Confirmed Pulmonary TB Cases Detected by NAAT in Wisconsin (2005-2010)
Slide 7 shows you the percentage of pulmonary TB cases we have been able to diagnose in Wisconsin using NAAT. We have seen an improvement over the last6 years, but are still well short of the Healthy People goal. So far in 2010 we have detected about 60% of our reported pulmonary TB cases. However, one third of our cases are extrapulmonary TB, so if we include them, we’re detecting only 40-45% of cases using NAAT.

5. FDA-Cleared Molecular TB Tests
FDA-Approved TB Molecular Assays for Respiratory Specimens
Amplified M. tb Direct Test® (MTD): Gen-Probe, Inc.
In slide 10 I show the FDA-cleared TB Molecular Assays for Respiratory Specimens. You’ll note that it’s a desert out there!
We’re down to one FDA-cleared test, the Amplified M. tb Direct Test (known as the MTD, or enchancedMTD) manufactured by Gen-Probe. The only other cleared test, the Amplicor M. tuberculosis (MTB) by Roche Diagnostics has been taken off the market in the U.S.
Cepheid GeneXpert ®

6. Nucleic Acid Amplification Tests
Commercial tests available outside US
BD ProbeTec™ MTB Direct Detection
COBAS® Amplicor® MTB Test
COBAS® TaqMan® MTB Test
Hain Genotype® Mycobacteria Series
Innogenetics INNO-LIPATM
Laboratory Developed Tests
Off-label use of FDA-approved tests
Slide 11 lists some of the commercial tests available outside of the US……..
Validated Laboratory developed tests, mainly real-time PCR assays, have been implemented in clinical and public health laboratories. We have recently implemented a real-time PCR for M. tb using the LightCycler platform.
Off-label us of FDA-cleared tests using non-respiratory specimens has also been validated and implemented in U.S. laboratories

7. Courtesy Angela Starks, CDC

8. 104,425 suspect TB patients 92,877 – not tested 88%
Use of NAAT by US Public Health Laboratories in 2008 – Starks et al. [CDC]
104,425 suspect TB patients
92,877 – not tested 88%
12,548 – tested 12%
This is data gathered in 2008 by Angela Starks and the TB laboratory group at CDC. Of 104,425 suspect TB patients, only 12%, 12,548 were tested with a nucleic acid amplification assay. Of these, almost half were tested in one state, Florida, which has an aggressive TB diagnosis program led by Max Salfinger.
So, these numbers show that access to nucleic acid amplification testing was very limited and the test under utilized in the United States in 2008.
5,855 from Florida
NAR2010 – P 77

9. Potential for point of care testing
GeneXpert System
Cepheid, Sunnyvale, CA
RT-PCR, < 2 hours
Slide 21
Most recently, Cepheid, with support from the Foundation for Innovative New Diagnostics, has developed a molecular-beacon based real-time PCR assay for the detection of M. tuberculosis complex and in addition, rifampin-resistance. The assay is performed on Cepheid’s GeneXpert System which is utilized in many clinical laboratories for the detection of infectious agents such as methicillin-resistant Staph aureus, group B strep, C. difficile, and enteroviruses. They have submitted data to the FDA for approval and when it becomes available it will significantly increase access to rapid NAAT. The GeneXpert requires minimal personnel training and less than 5 minutes of hands-on time. Because of this ease-of use, it has the potential to be used as a point of care test.
Potential for point of care testing

10. GeneXpert MTB/RIF Assay
Automated commercial system for identification of M. tuberculosis complex and detection of rifampin resistance
Decontamination, digestion, DNA extraction, amplification, and detection in same cartridge
Integrated positive control assures that a negative result is not due to NAA inhibitors in the specimen
Results in ~2 hours
Minimal hands on manipulation- technically simple
Platform is random access

11. GeneXpert Target: rpoB gene Nested PCR and molecular beacon technology
Same segment of the rpoB gene is used for detection of both M. tb complex and rifampin resistance
PCR amplifies a small region relevant for rifampin resistance; uses 5 probes to assess for mutations
Slide 23 shows the target of the assay, an 81 base-pair region of the RNA polymerase B subunit. 5 probes, shown in different colors on the bottom of the slide are used to assesss for mutation.

12. Nature Genetics Volume: 44, Pages: 106–110 Year published: (2012)
Iñaki Comas,1, 8 Sonia Borrell,2, 3 Andreas Roetzer,4 Graham Rose,1 Bijaya Malla,2, 3 Midori Kato-Maeda,5 James Galagan,6, 7 Stefan Niemann4 & Sebastien Gagneux2, 3

13. Genetics of Rifampin Resistance in M. tuberculosis
GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTG TCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
507
rpoB
533 *
* *
81 base pair core region
Insertion
TTC
TTCATG
Deletion
CCATTC
GGCACC
Del
AAC
CAGAAC
GACCAG
AATTCATGG
GAACAA
Changes in codon Ser531 and His526 account for more than 70% of the mutations with RIF resistance
Adapted from Ramaswamy & Musser Tubercule Lung Dis 79:3

14. M. Tb Complex PCR for All

15. finddiadnostics.org

16. MTB/Rif Assay design Molecular Beacon Target Hybrid
The MTB assay target is the 81 bp region (RRDR) of the rpoB gene.
Molecular
Beacon
Target
Hybrid
SPC
Example of Rif-Sensitive Profile – 5 probes are positive
Each probe is labeled with a different fluorophore, permitting simultaneous detection of the presence of wild type.

17. Challenges to Implementing NAAT Guidelines
Gen-Probe® MTD
Cepheid® MTB/RIF
Reagents
2 controls
3 patients $240
3 inhib ctrl
3 patients $234
Labor ($20/hr)
2 hrs $ 40
10 min $ 3
Direct costs per patient result
$ 93
$ 79
MTD: $30/test
Cepheid $78/test
Courtesy Ken Jost, Texas SPHL
MTD: $30/test
Cepheid: $78/test (includes equipment & service [lease or cash] & kit)

18. Limit of detection – 131 CFU/ml
Cepheid
Limit of detection – 131 CFU/ml
M. tuberculosis viability – minus 8 log
107 clinical specimens/suspicion of TB – Vietnam
100% - 29/29 AFB + / Culture +
84.6% - 33/39 AFB- /solid Culture +
71.7% - 38/53 AFB- / solid & broth Culture
Slide 25
This slide shows the results of a study reported in the J Clin. Micro this year on the Cepheid assay. They found a limit of detection of 131 colony forming units/ml which is getting closer to the sensitivity of broth cultures. Safety is a very important issue when working with M. tb and they showed that the assay’s buffer solution could reduce the number of viable organisms by at least 8 logs. They reported a small clinical trial using 107 specimens from patients in Vietnam suspected of having TB. Sensitivity was 100% in 29 smear Pos, Culture Pos samples, 84.6% in smear Neg, solid Culture Pos samples, and as you would expect, somewhat lower, 71.7% when compared to broth and solid culture methods.
M. Tb was not detected in 25/25 culture negative specimens
Helb et al. JCM 48: (2010)

19. Cepheid Boehme et al NEJM
Assessed Xpert MTB/RIF in 1730 patients
Peru
Azerbaijan
South Africa
India
Both suspected drug-sensitive and multidrug-resistant pulmonary TB
The performance of the Cepheid assay in a larger clinical study was reported this month in the N. Eng. J. of Medicine. They assessed the Xpert MTB/RIF assay in 1730 patients from high incident countries including Peru, Azerbaijan, S. Africa, and India. Both suspected drug-sensitive and multidrug-resistant pulmonary TB patients were included in the study.
Boehme, C.C. et al. NEJM 363: , 2010

20. Boehme et al Among AFB smear pos/culture pos patients
Single Direct MTB/RIF identified 98.2% (551/561)
Among AFB smear neg/culture pos
72.5% (124/171)
Addition of a second MTB/RIF increased sens to 85.1%
Addition of a third increased sens to 90.2%
Specificity > 98.1%
Slide 28 shows the results of their study.
I have an error on this slide-----the line that states that “96% with additional pelleted sample” should be deleted

21. Rifampin Resistance Boehme et al
Detection of rifampin resistance
Sensitivity of 99.1% (209/211)
Specificity of 100% (506)

22. Xpert Detection of Mtb in Pulmonary TB

23. Rifampin Resistance Detection in Pulmonary TB
Chang, K. Journal of Infection (2012) pp 1-9

24. Expert Performance in HIV Coinfected Population
Chang, K. Journal of Infection (2012) pp 1-9

25. Xpert Performance Breakdown
Chang, K. Journal of Infection (2012) pp 1-9

26. 2009 CDC Recommendations for use of NAAT
“NAAT should be performed on at least one respiratory specimen from each patient with signs and symptoms of pulmonary TB for whom a diagnosis of TB is being considered but has not yet been established, and for whom the test result would alter case management or TB control activities”
NAAT as standard practice
Now I’d like to review the CDC recommendations for NAAT that were publish in January of this year in MMWR. The crux of the recommendations is stated in this sentence, “….
The 2009 recommendations also state that NAAT should now be considered a standard of practice and not as a recommended option.
MMWR, 2009, 58:7-10

27. CDC Algorithm
Collect at least one respiratory specimen, preferably the first, for NAAT
Collect additional specimens for smear and culture
Must interpret NAAT results in correlation with the AFB smear results

28. First Respiratory Specimen
Smear Positive
Smear Negative
NAAT
NAAT
Positive:
Presumed TB,
Pending culture
results
Negative
Inhibitors Detected:
Test result is of no
diagnostic help.
Consider testing second
specimen (not to exceed
a total of two).
Positive
Negative
Use clinical judgment to
determine whether to
begin therapy while
awaiting culture results
and determine if
additional diagnostic
testing is needed.
Use clinical judgment to
determine whether to
begin therapy while
awaiting culture results
and determine if
additional diagnostic
testing is needed.
Use clinical judgment
to determine whether
to begin therapy while
awaiting results of
culture and other
diagnostic tests.
Currently available
NAA tests are not
sufficiently sensitive
to exclude the
diagnosis of TB in
AFB smear negative
patients suspected
of having TB.
Consider testing another specimen
(not to exceed a total of two).
Consider testing another specimen
(not to exceed a total of two).
If a second specimen is smear positive,
NAAT negative. the patient is presumed to
have an infection with non-tuberculous
mycobacteria, pending culture results,
NAAT Positive: A patient can be
presumed to have tuberculosis,
pending culture results, if two
specimens are NAA positive.

29. Who should be tested?
CDC recommends NAAT on first sputum of all patients SUSPECTED of TB for whom the test result would alter case management or TB control activities
NAAT should NOT be ordered routinely when clinical suspicion of TB is low.
Definition of a “suspect” case can vary among clinicians
Clinicians, TB programs, and laboratorians must collaborate to develop criteria/definition for patients to be tested
Let’s look at which patients NAAT should be used. As I previously stated, ……..

30. Wisconsin criteria for NAAT
Signs and symptoms
Risk factors
Patient in airborne isolation
Reported to local health department as a suspect case
At WSLH all initial smear positive respiratory specimens automatically tested with NAAT
Next slide should be 47
In Wisconsin the state TB program funds fee-exempt NAAT and the TB Controller was very concerned about inappropriate use of the test. Therefore, we established criteria for fee-exempt testing in Wisconsin using the following criteria:………

31. NAAT for release of patients suspected of pulmonary TB from Isolation
CDC Expert panel recommendations
Sputum that is NAAT negative and 2 additional sputums that are AFB smear negative.
Collected at 8-24 hour intervals, at least one of which is an early morning specimen
Should not be used when suspicion for TB is high enough to start TB medications.
Clinical response, usually 4-7 days treatment, and 3 smear negative sputums

32. Summary Advantages of NAAT More rapid diagnosis
Initiation of earlier treatment
Cost savings with reduced patient isolation
Faster reporting to TB Programs
Fewer transmissions
In summary, the advantages of NAAT include……….

33. Will make NAAT more widely available to suspect TB patients
GeneXpert
Will make NAAT more widely available to suspect TB patients
Earlier diagnosis
Approach 2020 goal
Will provide rapid detection of rifampin resistance and possible MDR-TB cases
Caveat---In population with low prevalence of rifampin resistance, predictive value will be poor (approx 56%)

34. NAAT is a supplemental test
GeneXpert
NAAT is a supplemental test
Does not replace AFB smear and culture
Smear needed for interpretation
Culture still the “Gold Standard” for TB diagnosis
In a low TB prevalence population, most smear positive specimens will be NTMs

35. Research Needs for Future Advancements
Studies to develop, evaluate, and select the most effective and efficient NAAT and culture algorithms
Develop better tests for non-respiratory specimens
Develop tests with improved performance and ease-of-use
Develop tests that will enhance the diagnosis of TB in children
Develop multiplex assays that can detect M. avium complex, M. kansasii and other NTM
Develop tests to detect resistance to both first and second line drugs
Develop tests that can be used in resource limited countries. Requires ease of use and low cost.
In slide 60 I just wanted to highlight some of out research needs for future advancement. …………….

36. Thank You