1. Automated Searching of Polynucleotide Sequences
Michael P. Woodward
Supervisory Patent Examiner - Art Unit 1631
John L. LeGuyader
Supervisory Patent Examiner - Art Unit 1635

2. Standard Databases GenEMBL .rge N_Genseq .rng Issued_Patents_NA .rni
EST .rst
Published_Applications_NA .rnpb

3. Databases at Time of Allowability
Pending_Patents_NA_Main .rnpm
Pending_Patents_NA_New .rnpn

4. Types of Nucleotide Sequence Searching
Standard (cDNA)
Oligomer
Length Limited Oligomer
Score over Length
Purposefully leaving out example where no specific search is requested

5. Types of Nucleotide Sequence Searching
Standard (cDNA)
useful for finding full length hits
the query sequence is typically the full length of the SEQ ID NO:
the search parameters are the default parameters-Gap Opening Penalty & Gap Extension Penalty of 10
standard suite of NA databases are searched
normally 45 results and the top fifteen alignments are provided, however, additional results and alignments can be provided.
Purposefully leaving out example where no specific search is requested

6. Standard (cDNA) search
Fragments and genomic sequences are often difficult to find
Fragments are buried in the hit list
The presence of introns in the database sequence results in low scores.

7. Types of Nucleotide Sequence Searching
Standard Oligomer
finds longest matching hits
– mismatches not tolerated in region of hit
match
Length Limited Oligomer
returns database hits within length range requested
mismatches not tolerated in region of hit match
Purposefully leaving out example where no specific search is requested

8. Standard Oligomer Searching
Only provides the longest oligomer present in the sequence
A thorough search of fragments requires multiple searches
Can be an effective way of finding genomic sequences

9. Standard Oligomer Searching
the search parameters are the default parameters-Gap Opening Penalty & Gap Extension Penalty of 60-mismatches not tolerated
Consequently inefficient means of finding small sequences, and with <100% in correspondence

10. Claim 1 An isolated polynucleotide comprising SEQ. ID. No: 1.
The claim is interpreted as reading on an isolated polynucleotide which contains within it the entirety of SEQ ID No: 1.

11. Searching Claim 1
A standard search looking for full length hits is performed.

12. Standard (cDNA) search result
0001 CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGATGG 0060
2031 CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGG---CAGATGG 2090

13. Claim 2
An isolated polynucleotide comprising at least 15 contiguous nucleotides of SEQ. ID. No: 1.

14. Searching Claim 2
An standard oligomer search is performed with an oligomer length of 15 nucleotides set as the lower limit for a hit.

15. Oligomer Search Results
Standard Oligomer
CAAATGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG
Query CCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 0060
Database CCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 2500
Length Limited Oligomer
CAAATGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 
Database CCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 0039

16. Claim 3
An isolated polynucleotide comprising a polynucleotide encoding a polypeptide of SEQ ID No: 2.
(SEQ ID No: 2 is an Amino Acid (AA) sequence)

17. Searching Claim 3
Seq ID No: 2 is searched against the Polypeptide databases and it is “back translated” and searched against the polynucleotide databases.

18. Claim 4
An isolated polynucleotide comprising a polynucleotide with at least 90% identity to SEQ ID No: 1.

19. Searching Claim 4
A standard search looking for full length hits is performed.
Hits having at least 90% identity will appear in the results.

20. Claim 5
An isolated polynucleotide comprising a polynucleotide which hybridizes under stringent conditions to SEQ ID No: 1.

21. Searching Claim 5
A standard oligomer search is performed as well as a standard search.

22. Searching Small Nucleotide Sequences
John L. LeGuyader

23. Types of Small Nucleotide Sequences Claimed
Fragments
Complements/Antisense
Primers/Probes
Oligonucleotides/Oligomers
Antisense/RNAi/Triplex/Ribozymes (inhibitory)
Accessible Target/Region within Nucleic Acids
Aptamers
Nucleic Acid Binding Domains
Immunostimulatory CpG Sequences
Non-limiting examples, others possible

24. Small Nucleotide Sequences Claimed as Sense or Antisense?
What is being claimed?
Requesting the correct sequence search starts with interpreting what is being claimed
Complementary Sequences
DNA to DNA: C to G
DNA to RNA: A to U
Matching Sequences
A to A
U to U
DNA, RNA, Chimeric
cDNA, Message (mRNA), Genomic DNA

25. Impact of Sequence Identity and Length
Size and Identity Matter
Complements/Matches
100% correspondence
Mismatches
- Varying Degrees of Percent Identity
Gaps
- Insertion or Deletions
- Gap Extensions
Wild Cards
% Query Match value approximates identity
Adjustment of search parameters (e.g. Smith-Waterman Gap values) influences % Query Match value
Hit Length, Mismatches and Gaps affect the score and % query match.
Impacts how the search orders the hits and impacts what hits are actually provided to, and reviewed by, the examiner.
Wild Cards need to be specifically dealt with by the search preparer.
% Query Match value is not necessarily a reliable identity value.

26. Types of Nucleotide Sequence Searching
Standard Search (cDNA)
Oligomer
finds database hits with longest regions of matching residues
– mismatches not tolerated in region of hit match
Length Limited Oligomer
returns database hits within requested length range
mismatches not tolerated in region of hit match
Score Over Length
– finds mismatched sequence database hits based on requested length and identity range
Purposefully leaving out example where no specific search is requested

27. Why doesn’t a standard search of the cDNA provide an adequate search of fragments?
Long length sequence hits with many matches and mismatches score higher and appear first on the hit list, compared to short sequences having high correspondence
lots of regional local similarity in a long sequence scores higher than a 10-mer with 100% identity
Consequence
small sequences, of 100% identity or less, are buried tens of thousands of hits down the hit list
most small sequence hits effectively lost
especially for hits with <100% correspondence

28. Fragments and types of sequence searches
Why doesn’t a standard search of the cDNA provide an adequate search of fragments?
Fragments and types of sequence searches
Standard Search (cDNA): fragment hits buried
oligomer: fragment hits buried
searching multiple fragments: millions of hits and alignments to consider
Each fragment of a specified sequence and length requires a separate search

29. Standard Oligomer Searching
Won’t provide thorough search of fragments since longer hits score higher on hit table
Smaller size hits lost, effectively not seen
Does not tolerate mismatches in region of matches
Consequently inefficient means of finding small sequences, and with <100% in correspondence
Better suited to finding long sequences

30. Length Limited Oligomer Searching
Sequence request needs to set size limit consistent with the size range being claimed
Does not tolerate mismatches in region of matches
Consequently inefficient means of finding small sequences with <100% in correspondence
Better suited to finding small sequences with 100% correspondence

31. Score Over Length Searching
Small oligos with <100% correspondence
within requested length and identity (>60%) range
Manual manipulation of first 65,000 hits
necessitates 2+ additional hrs. of searcher’s time
does not include computer search time
Calculation
Hit Score divided by Hit Length
for first 65,000 hits of table
Hits then sorted by Score/Length value
First 65,000 hits likely to contain small length sequence hits down to 60% identity
Additional hours needed for post-processing is a resource issue.

32. Searching Small Sequences: Example
Consider the following claim:
An oligonucleotide consisting of 8 to 20 nucleotides which specifically hybridizes to a nucleic acid coding for mud loach growth hormone (Seq. Id. No. X).
The specification teaches that oligonucleotides which specifically hybridize need not have 100% sequence correspondence.

33. Mud Loach Growth Hormone cDNA
670 nucleotides long
630 nucleotides in the coding region
210 amino acids

34. Standard Search GenBank Hit Table Against cDNA

35. Standard Search GenBank Hit Table Against cDNA

36. Standard Search GenBank Alignments Against cDNA

37. Standard Search GenBank Alignments Against cDNA

38. Oligomer Search GenBank Hit Table Against cDNA

39. Oligomer Search GenBank Hit Table Against cDNA

40. Oligomer Search GenBank Alignments Against cDNA

41. Oligomer Search GenBank Alignments Against cDNA

42. Length-Limited (8 to 20) Oligomer Search GenBank Hit Table cDNA

43. Length-Limited (8 to 20) Oligomer Search GenBank Hit Table cDNA

44. Length-Limited (8 to 20) Oligomer Search GenBank Alignments cDNA

45. Score/Length GenBank Hit Table Against cDNA: 8-20-mers down to 80%

46. Score/Length GenBank Hit Table Against cDNA: 8-20-mers down to 80%

47. Score/Length Alignments Against cDNA: 8-20-mers down to 80%

48. Score/Length Alignments Against cDNA: 8-20-mers down to 80%

49. QUESTIONS? Michael P. Woodward
Supervisory Patent Examiner - Art Unit 1631
John L. LeGuyader
Supervisory Patent Examiner - Art Unit 1635