1. Warm-up What is a karyotype? What are chromosomes?
Why is a karyotype useful?

2. Karyotype- an organized profile of all of a person's chromosomes
Karyotype- an organized profile of all of a person's chromosomes. In a karyotype, chromosomes are arranged and numbered by size, from largest to smallest.
Chromosomes – threadlike structures comprised of DNA and proteins
Be creating a genetic profile, it can help identify genetic problems as the cause of a disorder or disease

3. Karyotypes

4. Warm-up List three things you learned about DNA
What differences between DNA and RNA did you observe?

5. The Structure of DNA
All life on earth uses a chemical called DNA to carry its genetic code or blueprint. In this lesson we be examining the structure of this unique molecule.
{Point out the alligator’s eyes in the first picture.} By the way, can you make out what this is?
***************************************************************
[The goal of this presentation is to introduce high school biology students to the chemical structure of DNA. It is meant to be presented in the classroom while accompanying the teacher’s lecture, under the control of the teacher.]

6. DNA Song

7. We love DNA, made of nucleotides.
Sugar, phosphate and a base bonded down one side.
Adenine and thymine make a lovely pair,
cytosine without guanaine would feel very bare.
de-oxy-ribo-nucleic acid, DNA
RNA is ribo-nucleic acid.

8. History of DNA
Early scientists thought protein was the cell’s hereditary material because it was more complex than DNA
Proteins were composed of 20 different amino acids in long polypeptide chains

9. History of DNA Chromosomes are made of both DNA and protein
Experiments on bacteriophage viruses by Hershey & Chase proved that DNA was the cell’s genetic material
Radioactive 32P was injected into bacteria!

10. Deoxyribonucleic acid
DNA is often called the blueprint of life.
In simple terms, DNA contains the instructions for making proteins within the cell.
Why is DNA called the blueprint of life?

11. The Shape of the Molecule
DNA is a very long polymer.
The basic shape is like a twisted ladder or zipper.
This is called a double helix.
{Show students a model of the double helix. Explain what a spiral is and a helix is.}

12. DNA Stands for Deoxyribonucleic acid
Made up of subunits called nucleotides
Nucleotide made of:
1. Phosphate group
2. 5-carbon sugar
3. Nitrogenous base

13. Four nitrogenous bases
DNA has four different bases:
Cytosine C
Thymine T
Adenine A
Guanine G
These four bases are abbreviated by using their respective first letters.

14. Chromosomes are threadlike structures that contain genetic material
About 30,000 genes are found on each chromosome
Each gene on a chromosome is made up of DNA
Each chromosome can have up to 100 million base pairs!!

15. Discovery of DNA Structure
Erwin Chargraff showed the amounts of the four bases on DNA ( A,T,C,G)
In a body or somatic cell:
A = 30.3%
T = 30.3%
G = 19.5%
C = 19.9%

16. Chargaff’s Rule Adenine must pair with Thymine
Guanine must pair with Cytosine
The bases form weak hydrogen bonds T A G C

17. Chargraff’s Rule: Adenine and Thymine always join together A T
Cytosine and Guanine always join together
C G

18. Two Kinds of Bases in DNA
Pyrimidines are single ring bases.
Purines are double ring bases. N C O C C N C C N

19. Thymine and Cytosine are pyrimidines
Thymine and cytosine each have one ring of carbon and nitrogen atoms. C N O
cytosine C N O
thymine

20. Adenine and Guanine are purines
Adenine and guanine each have two rings of carbon and nitrogen atoms. C N O
Guanine C N
Adenine

21. Question: DNA 5’-CGTATG-3’
What would be the complementary DNA strand for the following DNA sequence?
DNA 5’-CGTATG-3’

22. Answer:
DNA 5’-GCGTATG-3’
DNA 3’-CGCATAC-5’

23. Try it on your own with the PBS DNA Workshop

24. Pairing Practice
AACGTACGATCGATGCACATGCATGGCTACGC

25. Question:
If there is 30% Adenine, how much Cytosine is present?

26. Answer: There would be 20% Cytosine Adenine (30%) = Thymine (30%)
Guanine (20%) = Cytosine (20%)
Therefore, 60% A-T and 40% C-G

27. DNA Double Helix “Rungs of ladder” Nitrogenous Base (A,T,G or C)
“Legs of ladder”
Phosphate &
Sugar Backbone

28. Two Stranded DNA
Remember, DNA has two strands that fit together something like a zipper.
The teeth are the nitrogenous bases but why do they stick together?
{Point to the 3-D model to show the parts as you discuss them.}

29. Hydrogen Bonds The bases attract each other because of hydrogen bonds.
Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA.
The bonds between cytosine and guanine are shown here with dotted lines C N O

30. Hydrogen Bonds, cont. C N O
When making hydrogen bonds, cytosine always pairs up with guanine
Adenine always pairs up with thymine
Adenine is bonded to thymine here

32. The Double Helix Molecule
The DNA double helix has two strands twisted together.
We will take apart the DNA molecule to see how it is put together.
First, we will look at one strand.

33. One Strand of DNA
The backbone of the molecule is alternating phosphates and deoxyribose sugar
The teeth are nitrogenous bases.
phosphate
deoxyribose
{Point to the 3-D mode, if you have one, to show the parts as you discuss them.}
bases

34. Nucleotides
O -P O O
ATP
One deoxyribose together with its phosphate and base make a nucleotide.
O -P O O
Nitrogenous
base C O
Phosphate
{Ask students where they have seen a similar molecule before in this class.
Answer: ATP Emphasize that nucleotides are the basic building blocks or units of a DNA molecule and that a single molecule has many millions of nucleotides.} C C C
Deoxyribose
ribose O

35. One Strand of DNA One strand of DNA is a polymer of nucleotides.
One strand of DNA has many millions of nucleotides.
{Point to the 3-D mode, if you have one, to show the parts as you discuss them.}

36. DNA Nucleotide O O=P-O N CH2 O C1 C4 C3 C2 Phosphate Group
Nitrogenous base
(A, G, C, or T)
CH2 O C1 C4 C3 C2 5
Sugar
(deoxyribose)

37. DNA Stands for Deoxyribonucleic acid
Made up of subunits called nucleotides
Nucleotide made of:
1. Phosphate group
2. 5-carbon sugar
3. Nitrogenous base

38. Pentose Sugar Sugars are numbered clockwise 1’ to 5’ CH2 O C1 C4 C3 C2
(deoxyribose)

39. Nitrogenous Bases Double ring PURINES Adenine (A) Guanine (G)
Single ring PYRIMIDINES
Thymine (T)
Cytosine (C)
A or G
T or C

40. Base-Pairings Purines only pair with Pyrimidines
Three hydrogen bonds required to bond Guanine & Cytosine C G
3 H-bonds

41. Two hydrogen bonds are required to bond Adenine & Thymine

42. Review What does DNA stand for? What shape does DNA have?
What are the subunits that comprise DNA?
What three things make up these sub-units
After which part of the subunit is DNA named?
Name the 4 bases and pair them according to Chargraff’s rule

43. Answers Deoxyribonucleic acid Double helix Nucleotides
5-carbon sugar, phosphate, nitrogen base
The sugar (deoxyribose)
Thymine pairs with Adenine
Cytosine pairs with Guanine

44. DNA and Replication

45. DNA Stands for Deoxyribonucleic acid
Made up of subunits called nucleotides
Nucleotide made of:
1. Phosphate group
2. 5-carbon sugar
3. Nitrogenous base

46. Pentose Sugar Sugars are numbered clockwise 1’ to 5’ CH2 O C1 C4 C3 C2
(deoxyribose)

47. O O=P-O N CH2 O C1 C4 C3 C2 Phosphate Group Nitrogenous base
(A, G, C, or T)
CH2 O C1 C4 C3 C2 5
Sugar
(deoxyribose)

48. The Strands are AntiparallelO 1 2 3 4 5 P O 1 2 3 4 5 G C T A

49. Antiparallel Strands One strand of DNA goes from 5’ to 3’ (sugars)
The other strand is opposite in direction going 3’ to 5’ (sugars)

50. Semiconservative Model of Replication
Idea presented by Watson & Crick
The two strands of the parental molecule separate, and each acts as a template for a new complementary strand
New DNA consists of 1 PARENTAL (original) and 1 NEW strand of DNA
DNA Template
New DNA
Parental DNA

51. DNA Replication Begins at Origins of Replication
Two strands open forming Replication Forks (Y-shaped region)
New strands grow at the forks
Replication
Fork
Parental DNA Molecule 3’ 5’

52. Enzyme Helicase unwinds and separates the 2 DNA strands by breaking the weak hydrogen bonds
Single-Strand Binding Proteins attach and keep the 2 DNA strands separated and untwisted

54. Primase is the enzyme that synthesizes the RNA Primer
DNA polymerase can then add the new nucleotides

55. Direction of Replication
DNA Replication
DNA polymerase can only add nucleotides to the 3’ end of the DNA
This causes the NEW strand to be built in a 5’ to 3’ direction
RNA
Primer
DNA Polymerase
Nucleotide 5’ 3’
Direction of Replication

56. Replication of Strands
Replication Fork
Point of Origin

57. Synthesis of the New DNA Strands
The Leading Strand is synthesized as a single strand from the point of origin toward the opening replication fork
RNA
Primer
DNA Polymerase
Nucleotides 3’ 5’

58. Synthesis of the New DNA Strands
The Lagging Strand is synthesized discontinuously against overall direction of replication
This strand is made in MANY short segments It is replicated from the replication fork toward the origin
RNA Primer
Leading Strand
DNA Polymerase 5’ 3’
Lagging Strand 5’ 3’

59. Lagging Strand Segments
Okazaki Fragments - series of short segments on the lagging strand
Must be joined together by an enzyme
Lagging Strand
RNA
Primer
DNA
Polymerase 3’ 5’
Okazaki Fragment

60. Joining of Okazaki Fragments
The enzyme Ligase joins the Okazaki fragments together to make one strand
Lagging Strand
Okazaki Fragment 2
DNA ligase
Okazaki Fragment 1 5’ 3’

61. Replication of Strands
Replication Fork
Point of Origin

62. DNA replication

63. Overview of Replication

64. Protein Synthesis

65. RNA RNA is similar to DNA except for three things:
RNA is single stranded
RNA has ribose sugar
RNA has the nitrogen base uracil (in place of thymine)

66. Transcription the synthesis of mRNA from a DNA template
bases add to make a strand of messenger RNA (mRNA)
Occurs in the nucleus

67. The mRNA now moves away from the DNA and leaves the cell's nucleus.
Outside the nucleus, ribosomes attach themselves to the RNA.
(remember this is where proteins are made)

68. Translation
The mRNA bases are grouped into sets of three, called codons.
Each codon has a complementary set of bases, called an anticodon.
Anticodons are a part of transfer RNA (tRNA) molecules.

69. Attached to each tRNA molecule is an amino acid

70. Warm-up
Please provide the corresponding mRNA, tRNA and amino acids for the following DNA sequence
5' – T A C A G A A C T - 3‘
Is this a leading or lagging strand? Explain.
What is a mutation?

71. DNA T A C A G A A C T mRNA A U G U C U U G A tRNA U A C A G A A C U
Amino acids – Methionine -Serine- STOP

72. According to the table, the codons GGG, GGA, GGC, GGU all code for A
According to the table, the codons GGG, GGA, GGC, GGU all code for A. glycine. B. glutamin acid. C. glutamine. D. alanine.

74. Mutation A change in a DNA sequence Can be caused by:
Mistakes in copying
Exposure to radiation
Exposure to chemicals (mutagens)

75. Proofreading New DNA
DNA polymerase initially makes about 1 in 10,000 base pairing errors
Enzymes proofread and correct these mistakes
The new error rate for DNA that has been proofread is 1 in 1 billion base pairing errors

76. DNA Damage & Repair
Chemicals & ultraviolet radiation damage the DNA in our body cells
Cells must continuously repair DAMAGED DNA
Excision repair occurs when any of over 50 repair enzymes remove damaged parts of DNA
DNA polymerase and DNA ligase replace and bond the new nucleotides together