Presentation is loading. Please wait.

Presentation is loading. Please wait.

A HOX Gene Mutation in a Family with Isolated Congenital Vertical Talus and Charcot- Marie-Tooth Disease  Antony E. Shrimpton, E. Mark Levinsohn, Justin.

Published byМилоје Стојадиновић Modified over 5 years ago

Similar presentations

Presentation on theme: "A HOX Gene Mutation in a Family with Isolated Congenital Vertical Talus and Charcot- Marie-Tooth Disease  Antony E. Shrimpton, E. Mark Levinsohn, Justin."— Presentation transcript:

1 A HOX Gene Mutation in a Family with Isolated Congenital Vertical Talus and Charcot- Marie-Tooth Disease  Antony E. Shrimpton, E. Mark Levinsohn, Justin M. Yozawitz, David S. Packard, Robert B. Cady, Frank A. Middleton, Antonio M. Persico, David R. Hootnick  The American Journal of Human Genetics  Volume 75, Issue 1, Pages (July 2004) DOI: /422015 Copyright © 2004 The American Society of Human Genetics Terms and Conditions

2 Figure 1 A, Pedigree showing individuals from whom DNA was isolated (bars below symbol). Individuals marked with an asterisk (*) were included in the original 10K Array linkage study. The bars represent the 2q31 chromosomal section between markers D2S124 and D2S1391. B, Critical-region haplotypes in affected individuals, in more detail. All 16 affected individuals—but no unaffected individuals—contain the same chromosomal section distal to D2S1267 and proximal to D2S2978 (boxed). V=CVT; M=CMT; B=CVT and CMT; N=unaffected. An asterisk (*) indicates a presumed 5–6 reversion mutation. The American Journal of Human Genetics  , 92-96DOI: ( /422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions

3 Figure 2 Radiographs of individual V:2 at age 9 years. Despite casting for CVT at age 6 mo, the left foot still shows CVT (A), and the right foot shows a high arch (arrow) and claw toes typical of CMT (B). n=navicular; T=talus; c=calcaneus. Adapted from E.M.L., A.E.S., D.S.P., R.B.C., and D.R.H. (unpublished data). The American Journal of Human Genetics  , 92-96DOI: ( /422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions

4 Figure 3 A, Electropherogram showing M319K mutation sequence. B, NlaIII digested 181-bp products, run on a 2% agarose gel from a subset of affected and unaffected family members. Since the HOXD10 M319K mutation does not alter a naturally occurring restriction enzyme recognition site, a primer (TCAAGATTTGGTTTCAAAACCGCCGC*A) was designed that would create an NlaIII site in combination with wild-type sequence but not with the M319K mutation. The American Journal of Human Genetics  , 92-96DOI: ( /422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions

5 Figure A1 Whole-genome haplotype–based parametric linkage map at LOD>1.88 The American Journal of Human Genetics  , 92-96DOI: ( /422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions

Download ppt "A HOX Gene Mutation in a Family with Isolated Congenital Vertical Talus and Charcot- Marie-Tooth Disease  Antony E. Shrimpton, E. Mark Levinsohn, Justin."

Similar presentations

Connexin Mutations in Skin Disease and Hearing Loss David P. Kelsell, Wei-Li Di, Mark J. Houseman The American Journal of Human Genetics Volume 68, Issue.

Connexin Mutations in Skin Disease and Hearing Loss David P. Kelsell, Wei-Li Di, Mark J. Houseman The American Journal of Human Genetics Volume 68, Issue.
Functional Analysis of the Neurofibromatosis Type 2 Protein by Means of Disease- Causing Point Mutations Renee P. Stokowski, David R. Cox The American.

Functional Analysis of the Neurofibromatosis Type 2 Protein by Means of Disease- Causing Point Mutations Renee P. Stokowski, David R. Cox The American.
The Gene for Glycogen-Storage Disease Type 1b Maps to Chromosome 11q23

The Gene for Glycogen-Storage Disease Type 1b Maps to Chromosome 11q23
Identification of a Major Susceptibility Locus for Restless Legs Syndrome on Chromosome 12q  Alex Desautels, Gustavo Turecki, Jacques Montplaisir, Adolfo.

Identification of a Major Susceptibility Locus for Restless Legs Syndrome on Chromosome 12q  Alex Desautels, Gustavo Turecki, Jacques Montplaisir, Adolfo.
Homozygous Defects in LMNA, Encoding Lamin A/C Nuclear-Envelope Proteins, Cause Autosomal Recessive Axonal Neuropathy in Human (Charcot-Marie-Tooth Disorder.

Homozygous Defects in LMNA, Encoding Lamin A/C Nuclear-Envelope Proteins, Cause Autosomal Recessive Axonal Neuropathy in Human (Charcot-Marie-Tooth Disorder.
Mapping of Autosomal Dominant Osteopetrosis Type II (Albers-Schönberg Disease) to Chromosome 16p13.3  Olivier Bénichou, Erna Cleiren, Jeppe Gram, Jens.

Mapping of Autosomal Dominant Osteopetrosis Type II (Albers-Schönberg Disease) to Chromosome 16p13.3  Olivier Bénichou, Erna Cleiren, Jeppe Gram, Jens.
Genetic Linkage of Paget Disease of the Bone to Chromosome 18q

Genetic Linkage of Paget Disease of the Bone to Chromosome 18q
Localization of a Gene (MCUL1) for Multiple Cutaneous Leiomyomata and Uterine Fibroids to Chromosome 1q42.3-q43  N.A. Alam, S. Bevan, M. Churchman, E.

Localization of a Gene (MCUL1) for Multiple Cutaneous Leiomyomata and Uterine Fibroids to Chromosome 1q42.3-q43  N.A. Alam, S. Bevan, M. Churchman, E.
Use of Homozygosity Mapping to Identify a Region on Chromosome 1 Bearing a Defective Gene That Causes Autosomal Recessive Homozygous Hypercholesterolemia.

Use of Homozygosity Mapping to Identify a Region on Chromosome 1 Bearing a Defective Gene That Causes Autosomal Recessive Homozygous Hypercholesterolemia.
Homozygous Deletion of the Very Low Density Lipoprotein Receptor Gene Causes Autosomal Recessive Cerebellar Hypoplasia with Cerebral Gyral Simplification 

Homozygous Deletion of the Very Low Density Lipoprotein Receptor Gene Causes Autosomal Recessive Cerebellar Hypoplasia with Cerebral Gyral Simplification 
Mutations in TPRN Cause a Progressive Form of Autosomal-Recessive Nonsyndromic Hearing Loss  Yun Li, Esther Pohl, Redouane Boulouiz, Margit Schraders,

Mutations in TPRN Cause a Progressive Form of Autosomal-Recessive Nonsyndromic Hearing Loss  Yun Li, Esther Pohl, Redouane Boulouiz, Margit Schraders,
An Autosomal Dominant Thrombocytopenia Gene Maps to Chromosomal Region 10p  Anna Savoia, Maria Del Vecchio, Antonio Totaro, Silverio Perrotta, Giovanni.

An Autosomal Dominant Thrombocytopenia Gene Maps to Chromosomal Region 10p  Anna Savoia, Maria Del Vecchio, Antonio Totaro, Silverio Perrotta, Giovanni.
A Novel Alu-Like Element Rearranged in the Dystrophin Gene Causes a Splicing Mutation in a Family with X-Linked Dilated Cardiomyopathy  Alessandra Ferlini,

A Novel Alu-Like Element Rearranged in the Dystrophin Gene Causes a Splicing Mutation in a Family with X-Linked Dilated Cardiomyopathy  Alessandra Ferlini,
L. M. Downey, T. J. Keen, E. Roberts, D. C. Mansfield, M. Bamashmus, C

L. M. Downey, T. J. Keen, E. Roberts, D. C. Mansfield, M. Bamashmus, C
The SPCH1 Region on Human 7q31: Genomic Characterization of the Critical Interval and Localization of Translocations Associated with Speech and Language.

The SPCH1 Region on Human 7q31: Genomic Characterization of the Critical Interval and Localization of Translocations Associated with Speech and Language.
A Combined Linkage-Physical Map of the Human Genome

A Combined Linkage-Physical Map of the Human Genome
The Gene for Glycogen-Storage Disease Type 1b Maps to Chromosome 11q23

The Gene for Glycogen-Storage Disease Type 1b Maps to Chromosome 11q23
Tamara Rogers, David Chandler, Dora Angelicheva, P. K

Tamara Rogers, David Chandler, Dora Angelicheva, P. K
A Family with Isolated Hyperparathyroidism Segregating a Missense MEN1 Mutation and Showing Loss of the Wild-Type Alleles in the Parathyroid Tumors  Bin.

A Family with Isolated Hyperparathyroidism Segregating a Missense MEN1 Mutation and Showing Loss of the Wild-Type Alleles in the Parathyroid Tumors  Bin.
Mapping of Primary Congenital Lymphedema to the 5q35.3 Region

Mapping of Primary Congenital Lymphedema to the 5q35.3 Region

Similar presentations

Ads by Google