1. Erythropoietin gene from a teleost fish, Fugu rubripes
by Chih-Fong Chou, Sumanty Tohari, Sydney Brenner, and Byrappa Venkatesh
Blood
Volume 104(5):
September 1, 2004
©2004 by American Society of Hematology

2. Comparisons of the Fugu and human Epo loci.
Comparisons of the Fugu and human Epo loci. (A) The transcription start site is shown by an arrow. Exons are shown as rectangles and introns shown as thin lines. The sizes of introns are shown. (B) Genes are shown as arrows, with the syntenic genes shown as filled arrows. The gene order at the human locus on Chr7 was obtained from the UCSC Human Genome Browser ( The human gene for N03Rik was identified in this study.
Chih-Fong Chou et al. Blood 2004;104:
©2004 by American Society of Hematology

3. The hydrophilicity plots for Epos from Fugu, human, horse, pig, and rat generated using Kyte & Doolittle hydrophilicity parameters.
The hydrophilicity plots for Epos from Fugu, human, horse, pig, and rat generated using Kyte & Doolittle hydrophilicity parameters. The location of the N-terminal amino acid residue of the signal peptide is shown. aa indicates amino acid.
Chih-Fong Chou et al. Blood 2004;104:
©2004 by American Society of Hematology

4. Expression pattern of the Fugu Epo gene.
Expression pattern of the Fugu Epo gene. (A) RT-PCR analysis. The Fugu Epo cDNA (fEpo) was amplified by RT-PCR using primers complementary to exons 2 and 3. The kidney tissue used for RNA extraction includes the head and the tail kidney. Actin was amplified as an internal control for the quality of Fugu cDNA. (B) Northern blot analysis. Each lane contains about 20 μg (brain, heart, kidney, ovary) or 10 μg (liver) of Fugu total RNA. The Epo transcript in the brain (1.54 kb) is shorter than that in the heart and liver (1.73 kb). A larger transcript of 3.1 kb is also found in these tissues. The sequence of this transcript is not clear from the exon-intron structure of Epo predicted by us.
Chih-Fong Chou et al. Blood 2004;104:
©2004 by American Society of Hematology

5. Fugu promoter analysis in a fish (top minnow) hepatoma cell line (PLHC-1).
Fugu promoter analysis in a fish (top minnow) hepatoma cell line (PLHC-1). (A) Schematic representation of the luciferase (Luc) reporter gene constructs. Fugu Epo locus is shown at the top. The transcription start site is shown by an arrow. (B) The luciferase activity of pGL-basic (PGL3-basic) and pGL3-control (PGL3-SV40) vectors transfected into the PLHC-1 cell line. SV40-promoter/enhancer driven pGL3-control vector, which was used as a positive control, showed up to 115-fold increase in the luciferase activity. (C) The luciferase activity of various promoter-luciferase constructs transfected into the PLHC-1 cell line. The level of luciferase activity obtained with various fEpo promoter-luciferase constructs was significantly higher (P < .05) than that of the pGL3-basic vector. (D) The luciferase activity of the various promoter-luciferase constructs under normal conditions (control), in the presence of cobalt chloride (CoCl2), under hypoxic conditions, and under anaerobic conditions. *Significantly different from the corresponding control at P < .05. RLU indicates relative light unit. The data shown are the mean (n = 3) ± standard error of the mean.
Chih-Fong Chou et al. Blood 2004;104:
©2004 by American Society of Hematology

6. Expression of Fugu Epo in PLHC-1 and HepG2 cell lines.
Expression of Fugu Epo in PLHC-1 and HepG2 cell lines. An 11-kb genomic fragment of the Fugu Epo was transfected into the PLHC-1 (A) or HepG2 (B) cell lines that were cultured under normal (Control), hypoxic, or anaerobic conditions, or in the presence of cobalt chloride (CoCl2). HepG2 cells did not survive under anaerobic conditions. The expression of Fugu Epo (fEpo) was analyzed by RT-PCR. PCR was also done with an aliquot of the RNA treated with DNAse that was used to synthesize cDNA (fEpo(-RT)) to check for residual genomic DNA in the cDNA preparations. The larger fEpo band (290 bp) represents unspliced transcript and the smaller band (193 bp) the spliced transcript. Endogenous actin or human glyceraldehyde-3-phosphate dehydrogenase (hG3PDH) fragment was amplified as an internal control. Both were found to be efficiently spliced. The following primers were used to amplify hG3PDH: 5′ACCACAGTCCATGCCATCAC3′ and 5′TCCACCACCCTGTTGCTGTA3′.
Chih-Fong Chou et al. Blood 2004;104:
©2004 by American Society of Hematology