Presentation is loading. Please wait.

Presentation is loading. Please wait.

Beatriz Garcillán, MS, Marina S

Published byHanna-Mari Hakala Modified over 5 years ago

Similar presentations

Presentation on theme: "Beatriz Garcillán, MS, Marina S"— Presentation transcript:

1 Enrichment of the rare CD4+ γδ T-cell subset in patients with atypical CD3δ deficiency 
Beatriz Garcillán, MS, Marina S. Mazariegos, MS, Paul Fisch, MD, PhD, Pieter C. Res, PhD, Miguel Muñoz-Ruiz, MS, Juana Gil, MD, PhD, Eduardo López-Granados, MD, PhD, Edgar Fernández-Malavé, PhD, José R. Regueiro, PhD  Journal of Allergy and Clinical Immunology  Volume 133, Issue 4, Pages e9 (April 2014) DOI: /j.jaci Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

2 Fig 1 T-lymphocyte analyses in 2 patients with atypical CD3δ deficiency. A, Absolute αβ and γδ (top) and DN, CD8+, and CD4+ γδ (bottom) T-cell numbers (mean ± SD) in comparison with the normal age-matched distribution in percentiles. B, γδ T-cell repertoire analysis by Vδ CDR3 length profiling. Abscissae are base pairs as indicated. Ordinates are peak heights. TCRD spectratyping is very variable in controls (see Fig E1 for further examples) but can be used to exclude clonal γδ T-cell expansions. C, TCRγδ+ cell distribution between CD4− and CD4+ subsets (upper quadrants). DN, Double negative. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

3 Fig 2 Comparative phenotypic and functional characteristics of γδ CD4+ versus CD4− T cells. A, Surface CD3 (and CD4) expression. αβ T cells are shown for reference. Similar results for AIII.1 (not shown) and with TCR-specific mAb.4 Numbers are control/patient MFI ratios. Vertical lines indicate background staining. B, Expression of activation markers. C, Cultured γδ T-cell activation (% CD69+ cells 24 hours after stimulation). MFI, Mean fluorescence intensity. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

4 Fig E1 γδ T-cell repertoire analysis by Vδ CDR3 length profiling in 3 unrelated normal controls, to illustrate the variability of TCRD spectratyping. Abscissae are base pairs as indicated. Ordinates are peak heights. The orange peaks along abscissae are molecular weight standards. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

5 Fig E2 Relative αβ and γδ T-cell numbers (top) and DN, CD8+, and CD4+ γδ T-cell numbers (bottom). DN, Double negative. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

6 Fig E3 Phenotypical characterization of cultured γδ T cells. A, TCRγδ+ cell distribution between CD4− and CD4+ subsets (upper quadrants). B, Vδ1, Vδ2, and Vγ9 usage within CD4+ or CD4− γδ T-cell subsets. C, Intracellular CD3δ levels detected in permeabilized T cells by using APA1/2 after gating for TCRαβ or TCRγδ, respectively. The vertical lines indicate the upper limit staining of the isotype control. The numbers in each histogram indicate control/patient MFI ratios. MFI, Mean fluorescence intensity. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

7 Fig E4 γδ T-cell subsets in human CD3γ deficiency.E1 The numbers indicate the TCRγδ+ cell distribution between the CD4− and CD4+ subsets (upper quadrants) in fresh PBMCs compared with a control. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

8 Fig E5 CD3δ KD in primary T cells. A, PBMCs from healthy donors were infected with lentiviruses carrying shRNA for CD3δ (GAGGACAGAGTGTTTGTGAAT) or no shRNA (empty) cloned in pLKO.1. After selection with puromycin, GFP+ cells were analyzed for surface TCR expression by using anti-CD3 mAb (SK7) and normalized to the empty vector (n = 2, mean ± SD). αβ T cells were gated as TCRαβ+ (IP26) and γδ T cells as TCRγδ+ (IMMU510). B, KD specificity was ascertained in permeabilized samples by flow cytometry using CD3δ-specific or, as a negative control, CD3γ-specific mAb to probe for intracellular CD3 expression (iCD3δ [EPR4426] and iCD3γ [EPR4517] from Abcam). The numbers in each histogram indicate empty/shCD3δ MFI ratios. KD, Knock down; MFI, mean fluorescence intensity. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

9 Fig E6 Heterogeneous surface TCR levels in γδ versus αβ T cells. Anti-CD3 mAb (SK7) MFI is represented within gated αβ (IP26+) and γδ (IMMU510+) T cells from 39 different healthy donors. In addition to the reported higher surface TCR MFI in γδ T cells,E2 variance (S2) homogeneity was compared by using the Snedecor F distribution test with 38 and 38 degrees of freedom. MFI, Mean fluorescence intensity. Journal of Allergy and Clinical Immunology  , e9DOI: ( /j.jaci ) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Download ppt "Beatriz Garcillán, MS, Marina S"

Similar presentations

Ana V. Marin, MSc, Anaïs Jiménez-Reinoso, MSc, Alejandro C

Ana V. Marin, MSc, Anaïs Jiménez-Reinoso, MSc, Alejandro C
Vitamin D3 treatment of vitamin D–insufficient asthmatic patients does not alter immune cell function  Brandy Reid, MS, Pierre-Olivier Girodet, MD, PhD,

Vitamin D3 treatment of vitamin D–insufficient asthmatic patients does not alter immune cell function  Brandy Reid, MS, Pierre-Olivier Girodet, MD, PhD,
Defective calcium signaling and disrupted CD20–B-cell receptor dissociation in patients with common variable immunodeficiency disorders  Annick A.J.M.

Defective calcium signaling and disrupted CD20–B-cell receptor dissociation in patients with common variable immunodeficiency disorders  Annick A.J.M.
Expression of IL-9 receptor α chain on human germinal center B cells modulates IgE secretion  Lama M. Fawaz, PhD, Ehssan Sharif-Askari, PhD, Oumnia Hajoui,

Expression of IL-9 receptor α chain on human germinal center B cells modulates IgE secretion  Lama M. Fawaz, PhD, Ehssan Sharif-Askari, PhD, Oumnia Hajoui,
Topical application of a vitamin D3 analogue and corticosteroid to psoriasis plaques decreases skin infiltration of TH17 cells and their ex vivo expansion 

Topical application of a vitamin D3 analogue and corticosteroid to psoriasis plaques decreases skin infiltration of TH17 cells and their ex vivo expansion 
Flow cytometry imaging identifies rare TH2 cells expressing thymic stromal lymphopoietin receptor in a “proallergic” milieu  Amanda J. Reefer, MS, Kathryn.

Flow cytometry imaging identifies rare TH2 cells expressing thymic stromal lymphopoietin receptor in a “proallergic” milieu  Amanda J. Reefer, MS, Kathryn.
Reduced TH1/TH17 CD4 T-cell numbers are associated with impaired purified protein derivative–specific cytokine responses in patients with HIV-1 infection 

Reduced TH1/TH17 CD4 T-cell numbers are associated with impaired purified protein derivative–specific cytokine responses in patients with HIV-1 infection 
A case of partial dedicator of cytokinesis 8 deficiency with altered effector phenotype and impaired CD8+ and natural killer cell cytotoxicity  Raquel.

A case of partial dedicator of cytokinesis 8 deficiency with altered effector phenotype and impaired CD8+ and natural killer cell cytotoxicity  Raquel.
Reduced IFN-γ receptor expression and attenuated IFN-γ response by dendritic cells in patients with atopic dermatitis  Eva Gros, MSc, Susanne Petzold,

Reduced IFN-γ receptor expression and attenuated IFN-γ response by dendritic cells in patients with atopic dermatitis  Eva Gros, MSc, Susanne Petzold,
CD4+ T cells in patients with chronic inflammatory rheumatic disorders show distinct levels of exhaustion  Theresa Frenz, PhD, Elena Grabski, PhD, Daniela.

CD4+ T cells in patients with chronic inflammatory rheumatic disorders show distinct levels of exhaustion  Theresa Frenz, PhD, Elena Grabski, PhD, Daniela.
Immunologic defects in 22q11.2 deletion syndrome

Immunologic defects in 22q11.2 deletion syndrome
Penicillium marneffei infection and impaired IFN-γ immunity in humans with autosomal- dominant gain-of-phosphorylation STAT1 mutations  Pamela P.W. Lee,

Penicillium marneffei infection and impaired IFN-γ immunity in humans with autosomal- dominant gain-of-phosphorylation STAT1 mutations  Pamela P.W. Lee,
Anti–IL-5 (mepolizumab) therapy reduces eosinophil activation ex vivo and increases IL- 5 and IL-5 receptor levels  Miguel L. Stein, MD, Joyce M. Villanueva,

Anti–IL-5 (mepolizumab) therapy reduces eosinophil activation ex vivo and increases IL- 5 and IL-5 receptor levels  Miguel L. Stein, MD, Joyce M. Villanueva,
Assessing basophil activation by using flow cytometry and mass cytometry in blood stored 24 hours before analysis  Kaori Mukai, PhD, Nicolas Gaudenzio,

Assessing basophil activation by using flow cytometry and mass cytometry in blood stored 24 hours before analysis  Kaori Mukai, PhD, Nicolas Gaudenzio,
Topical application of a vitamin D3 analogue and corticosteroid to psoriasis plaques decreases skin infiltration of TH17 cells and their ex vivo expansion 

Topical application of a vitamin D3 analogue and corticosteroid to psoriasis plaques decreases skin infiltration of TH17 cells and their ex vivo expansion 
Type 2 innate lymphoid cells in induced sputum from children with severe asthma  Prasad Nagakumar, MBBS, Laura Denney, PhD, Louise Fleming, MD, Andrew.

Type 2 innate lymphoid cells in induced sputum from children with severe asthma  Prasad Nagakumar, MBBS, Laura Denney, PhD, Louise Fleming, MD, Andrew.
Identification of a subset of human natural killer cells expressing high levels of programmed death 1: A phenotypic and functional characterization  Silvia.

Identification of a subset of human natural killer cells expressing high levels of programmed death 1: A phenotypic and functional characterization  Silvia.
Defects in lymphocyte telomere homeostasis contribute to cellular immune phenotype in patients with cartilage-hair hypoplasia  Geraldine Aubert, PhD,

Defects in lymphocyte telomere homeostasis contribute to cellular immune phenotype in patients with cartilage-hair hypoplasia  Geraldine Aubert, PhD,
Type 3 innate lymphoid cells induce proliferation of CD94+ natural killer cells  Shuo Li, PhD, Hideaki Morita, MD, PhD, Beate Rückert, Sci Tec, Tadech.

Type 3 innate lymphoid cells induce proliferation of CD94+ natural killer cells  Shuo Li, PhD, Hideaki Morita, MD, PhD, Beate Rückert, Sci Tec, Tadech.
The BLNK adaptor protein has a nonredundant role in human B-cell differentiation  Chantal Lagresle-Peyrou, PhD, Michèle Millili, Sonia Luce, Annie Boned,

The BLNK adaptor protein has a nonredundant role in human B-cell differentiation  Chantal Lagresle-Peyrou, PhD, Michèle Millili, Sonia Luce, Annie Boned,

Similar presentations

Ads by Google