1. (codes for amino acids)
A gene is composed of two parts: ON
OFF
regulatory
region
(on/off switch)
coding region
(codes for amino acids)

2. Transcription factors turn genes on and off.
Transcription factors are proteins that bind
to a specific base sequence in DNA.
…AGCCTACCAAAAAAGGTTCCACG…
…TCGGATGGTTTTTTCCAAGGTGC…

3. (codes for amino acids)
Some transcription factors are activators:
They turn genes ON.
regulatory
region
(on/off switch)
coding region
(codes for amino acids)

4. (codes for amino acids)
Some transcription factors are activators:
They turn genes ON.
- Some transcription factors are repressors:
They turn genes OFF.
regulatory
region
(on/off switch)
coding region
(codes for amino acids)

5. Concepts 1. What is a mutant?
2. How is hereditary information passed on
from one generation to the next? What
are the rules?
3. The same rules apply to all plants and animals.

10. Normal Fly

11. White Eyes Mutant

12. Dark Body Mutant

13. Tiny Wing Mutant

14. Wings Held-Out Mutant

15. What is a mutant?
A mutant is different than “normal”.
The mutant characteristic is passed
on to the next generation.

16. Fruit Flies
normal
wing mutant

17. normal
wing mutant

18. Genes
Genes are the basic units of inheritance.
Plants and animals have two copies of every gene.
Mom and dad each pass on only one copy of every gene to their children.

19. Genes Genes can be working (“good”) or broken (“bad”).
One “good” copy of a gene is all that
is needed to be normal.
A mutant has two “bad” copies of a gene.

20. +/+ +/+ x x Each offspring gets one copy of the gene from each parent.
normal
(has 2 good copies
of wing gene)
+/+ x
parents:
+/+
offspring:
Each offspring gets one copy of the gene
from each parent.
All offspring are normal.

21. -/- -/- x x Each offspring gets one copy of the gene from each parent.
wingless mutant
(has 2 bad copies
of wing gene)
-/- x
parents:
-/-
offspring:
Each offspring gets one copy of the gene from
each parent.
All offspring have 2 bad copies of wing gene.
All offspring are wingless.

22. +/+ -/- +/- x x All offspring look normal because they only
(has 2 good copies
of wing gene)
mutant
(has 2 bad copies
+/+
-/- x
parents:
+/-
offspring:
All offspring look normal because they only
need one good copy of the wing gene.
All offspring are “carriers” for a mutant copy
of the wing gene.

23. + / - +/+ +/- -/+ -/- x x carrier carrier offspring:
These flies look normal because
they only need one good copy of
the wing gene.
These flies have no wings
because they have two bad
copies of the wing gene.

24. Cells Communicate with Each Other Through Signals and Receptors

25. Cells Communicate with Each Other Through Signals and Receptors
Some signals are secreted and can travel
several cells away.

26. Cells Communicate with Each Other Through Signals and Receptors
Some signals are tethered and can only
influence adjacent cells.

27. Cells Communicate with Each Other Through Signals and Receptors
Receptors sense signals and become activated.
Activated receptors act to alter gene expression.

28. A Morphogen is a Developmentally Important Type of Secreted Signal
Morphogens have the following characteristics:
1. They are synthesized in some but not all cells.
2. They diffuse from the site of synthesis and are less
concentrated the farther away from the source of synthesis.
3. Cells respond to different morphogen concentrations by
activating expression of distinct sets of genes.

29. Morphogens

30. The dpp gene promotes skin development.
In dpp mutants, skin is replaced by
nervous system.

31. The dpp gene is normally expressed in
cells that will form skin.
What would happen if the dpp gene was
misexpressed in cells that would normally
form the nervous system?

32. Misexpression Experiment
Normal embryo
Dorsal
Ventral
Misexpression of dpp converts cells that
would normally form nervous system into
skin.

33. The ag gene promotes stamen
development
stamen
petal
normal
ag mutant
In ag mutants, stamens are replaced by petals.

34. The ag gene is normally expressed in stamens
ag mutant
What would happen if the ag gene was
misexpressed in cells that would normally
form petals?

35. Misexpression Experiment
normal
ag mutant
ag misexpression
Misexpression of ag causes cells that would
normally form petals to form stamens.